ID: 1176334679

View in Genome Browser
Species Human (GRCh38)
Location 21:5584971-5584993
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 5, 1: 1, 2: 0, 3: 9, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176334679_1176334681 -10 Left 1176334679 21:5584971-5584993 CCATGGTTGGTGTGAGTAGGCTT 0: 5
1: 1
2: 0
3: 9
4: 105
Right 1176334681 21:5584984-5585006 GAGTAGGCTTGGACACCTGCAGG 0: 6
1: 1
2: 2
3: 23
4: 116
1176334679_1176334689 27 Left 1176334679 21:5584971-5584993 CCATGGTTGGTGTGAGTAGGCTT 0: 5
1: 1
2: 0
3: 9
4: 105
Right 1176334689 21:5585021-5585043 ATAATCAACTGGGCCTTCAGTGG 0: 9
1: 1
2: 0
3: 17
4: 139
1176334679_1176334685 16 Left 1176334679 21:5584971-5584993 CCATGGTTGGTGTGAGTAGGCTT 0: 5
1: 1
2: 0
3: 9
4: 105
Right 1176334685 21:5585010-5585032 GACACCCAGGAATAATCAACTGG 0: 9
1: 0
2: 0
3: 9
4: 95
1176334679_1176334682 -9 Left 1176334679 21:5584971-5584993 CCATGGTTGGTGTGAGTAGGCTT 0: 5
1: 1
2: 0
3: 9
4: 105
Right 1176334682 21:5584985-5585007 AGTAGGCTTGGACACCTGCAGGG 0: 6
1: 1
2: 2
3: 18
4: 140
1176334679_1176334683 3 Left 1176334679 21:5584971-5584993 CCATGGTTGGTGTGAGTAGGCTT 0: 5
1: 1
2: 0
3: 9
4: 105
Right 1176334683 21:5584997-5585019 CACCTGCAGGGCAGACACCCAGG 0: 6
1: 0
2: 5
3: 34
4: 338
1176334679_1176334686 17 Left 1176334679 21:5584971-5584993 CCATGGTTGGTGTGAGTAGGCTT 0: 5
1: 1
2: 0
3: 9
4: 105
Right 1176334686 21:5585011-5585033 ACACCCAGGAATAATCAACTGGG 0: 9
1: 0
2: 1
3: 12
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176334679 Original CRISPR AAGCCTACTCACACCAACCA TGG (reversed) Intergenic
900949356 1:5849236-5849258 AAGCCTCCCCTCACCATCCAGGG + Intergenic
904566017 1:31428899-31428921 CAGCCCACTCACACCAGCCAAGG - Intronic
906793614 1:48679427-48679449 AAGCCTGCTCAGTACAACCAGGG + Intronic
908832077 1:68189613-68189635 AAGACTAATCTCACTAACCAAGG + Intronic
910666384 1:89729355-89729377 AAGCCTGCTTAGACCAACCCAGG - Intronic
910667080 1:89737269-89737291 AAACCTACTTACACAAACCTAGG + Intronic
921480888 1:215663509-215663531 CACGCTACACACACCAACCACGG - Intronic
924874812 1:248090553-248090575 TAGCCTAAGCAAACCAACCAAGG - Intronic
1063246398 10:4224176-4224198 AAAGCTACTCAGAACAACCACGG - Intergenic
1066037557 10:31508652-31508674 ATGCCTACACACACCACCAAGGG - Intronic
1068065397 10:52124252-52124274 GAGTCTACTCACACAAACCTAGG + Intronic
1068227376 10:54123472-54123494 ATACCTACTCACACCAGTCAGGG + Intronic
1068617507 10:59135746-59135768 AAGCCTAATGACACTGACCAAGG - Intergenic
1069393565 10:67963726-67963748 AAACCCTCACACACCAACCAGGG - Intronic
1070663544 10:78327830-78327852 AATACTACACACACCAACCAGGG - Intergenic
1070942312 10:80358056-80358078 AAGCCCACTCAGACCAACTTAGG - Intronic
1073835337 10:107434983-107435005 AAGCTTTCTCCAACCAACCATGG + Intergenic
1075482288 10:122792243-122792265 AAGCCTAGTGAAACCAACCATGG + Intergenic
1076673105 10:132133843-132133865 CAGCCTCCTCCCACCAACCCAGG - Intronic
1077574996 11:3376198-3376220 CAGACTGCTCACAGCAACCATGG - Intronic
1084203422 11:67577136-67577158 GAGCCTTCCCACACCTACCAGGG - Intergenic
1097056508 12:56253220-56253242 CAGACTGCTCACATCAACCATGG - Intronic
1098905187 12:76154606-76154628 AAGCCTACTCTCACAGCCCATGG - Intergenic
1099243270 12:80163683-80163705 AAGCCAAATCACCCCAGCCAAGG - Intergenic
1105728153 13:23186139-23186161 AAGGCTACTCAGACCAGCCAGGG - Intronic
1113423750 13:110190438-110190460 AAACCTGCTCAGACCAACCTGGG + Intronic
1117788721 14:59315341-59315363 AAGTCTACTTACAGCAGCCATGG - Exonic
1118270011 14:64334388-64334410 AGGCCTACTCCCAACAGCCAGGG - Intronic
1118354470 14:65001437-65001459 GAGTATACTCACACCAACCTGGG - Intronic
1121565944 14:94909021-94909043 AAGCCTGCTGACTCCAAACATGG + Intergenic
1131239839 15:90729725-90729747 AAGCATATTCACAACATCCAAGG + Intronic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133025036 16:2985450-2985472 AAGGCAACTCACACCAGCAAAGG - Intergenic
1133556974 16:6915008-6915030 AAGCCGACTTACACCACCCTGGG - Intronic
1135903778 16:26491486-26491508 GAGCCTACTCAGGGCAACCATGG + Intergenic
1136129155 16:28208522-28208544 AATCCTATTCACATCAACTATGG + Intronic
1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG + Intronic
1141611191 16:85182089-85182111 AAGGCTGTTCACACCAAGCATGG + Intronic
1144126241 17:12205570-12205592 AAGCCTTCTCACATCATCCCAGG - Intergenic
1149342307 17:55699459-55699481 AAGCCAACTCCCACCACCCTAGG + Intergenic
1158616046 18:58987932-58987954 AAGCCTACTCCCACCACCCTAGG - Intergenic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1162704826 19:12547650-12547672 CAGCCTTATCACTCCAACCAGGG - Intronic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG + Intronic
1163957729 19:20659903-20659925 AAGACTGCTCACCCCAGCCACGG - Intronic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164225934 19:23245978-23246000 TAGCCTGCTCACTCCAGCCATGG - Intronic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1164839314 19:31380629-31380651 CAGCCTCCTCTCAGCAACCACGG - Intergenic
1164888661 19:31804633-31804655 AAACCTACTCAAACCTACTAGGG - Intergenic
925085199 2:1102309-1102331 CAGCCTCCTCACAACAGCCAGGG - Intronic
925323161 2:2992768-2992790 AAGGACACTCACACCAAACAGGG + Intergenic
927326331 2:21809874-21809896 TAGGCTACAAACACCAACCAAGG - Intergenic
933177829 2:79195782-79195804 AATCCTCCTCACACAAAGCAAGG + Intronic
944260713 2:197673217-197673239 AAGCCTCCTCCCAGCAACCCAGG + Intronic
946101079 2:217324059-217324081 AAGACTTCTCACAGCAACAATGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176362502 21:6009749-6009771 AAGGCAACTCTCACCAATCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1179761016 21:43528796-43528818 AAGGCAACTCTCACCAATCATGG + Intergenic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1181746058 22:24955653-24955675 CAGCCTCCCCACACCAGCCAGGG - Intronic
1183937727 22:41273171-41273193 TTGCCTGCTCACAGCAACCAGGG - Intronic
950482469 3:13253062-13253084 AAGCAACCTCACACCCACCAGGG - Intergenic
951209701 3:19961958-19961980 AAGCCCACTCACCAGAACCATGG - Intronic
952541610 3:34373171-34373193 GAGGCTAGTCACACCAGCCAGGG + Intergenic
953389391 3:42525777-42525799 AGCCCTACTCCCACCAACCCTGG - Intronic
960405439 3:117253681-117253703 AAGCCTCCTCCCTCCAGCCATGG - Intergenic
967110694 3:186290934-186290956 ATGCCTATTCCCACCAACCAGGG + Intronic
968262155 3:197334235-197334257 AAGTCTACTCACCCCAACGGAGG + Intergenic
971914632 4:32851708-32851730 CAACCTACTGACACCAGCCAGGG - Intergenic
972666781 4:41172414-41172436 AAGGCTTCTCTCACCAACCTCGG + Intronic
976899120 4:90152317-90152339 TAACCTACACACACCAATCAAGG - Intronic
980649455 4:135692103-135692125 AAGAAACCTCACACCAACCATGG + Intergenic
980935107 4:139218914-139218936 AAGCAAACACACACCAACCTGGG + Intergenic
981652516 4:147075950-147075972 AAGCCAACTAACACCAAAGATGG + Intergenic
987642930 5:20634435-20634457 ATGCCTACACACACGAGCCACGG + Intergenic
996955647 5:129180349-129180371 AAGCCTAACCATATCAACCAAGG - Intergenic
997404512 5:133634243-133634265 ATCCCTACACACACCAACAAAGG - Intergenic
1000886004 5:166747969-166747991 AAGGCTACTCATACCACCCATGG + Intergenic
1001865760 5:175103990-175104012 AAGCCTGCTAGCACCAACAACGG - Intergenic
1013632167 6:111996225-111996247 AAGCCTCCTCACAGAAGCCACGG + Intergenic
1013968061 6:115979880-115979902 AAGTGTACTCACACAAACCTAGG - Intronic
1016302992 6:142652588-142652610 AAACCTACTAACACCTACTATGG + Intergenic
1018886840 6:167946052-167946074 AAGCAAACACACACCACCCAAGG + Intronic
1020280502 7:6647769-6647791 TAGCCCACACACACCACCCATGG - Intronic
1020781196 7:12518662-12518684 AAGCCTGAGCACACCACCCAAGG - Intergenic
1022469720 7:30674803-30674825 AATCCTGCTCACACCAAGAATGG - Intronic
1023055360 7:36286021-36286043 AAGCCTCCTAACACCACCCTGGG + Intronic
1023891334 7:44393996-44394018 AAACCTACCCACACCAAAGAAGG + Intronic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG + Intergenic
1025802271 7:64797574-64797596 GAGCCTGCTCACCCCAGCCATGG + Intronic
1032000070 7:128259517-128259539 AAGCCAACTCCCCCCACCCAAGG + Intergenic
1033566720 7:142585925-142585947 AAGTCTACTCTCACCATCTAAGG - Intergenic
1037950833 8:23017943-23017965 AAGCCTACTCACACCCTCACTGG + Exonic
1038346743 8:26740017-26740039 AGGCATACACACACCAAACATGG + Intergenic
1040518398 8:48153474-48153496 AAGCCTGCTCTCTCCAACCAAGG + Intergenic
1043390892 8:79790639-79790661 AGGCCTACTCAAATGAACCAAGG - Intergenic
1047248268 8:123162571-123162593 AAGCCAAGTCACTCCAAACAGGG + Intergenic
1050014966 9:1223837-1223859 AAGCCTTCTTAACCCAACCAAGG + Intergenic
1053030918 9:34777315-34777337 ATGCCAGCACACACCAACCAGGG - Intergenic
1055720293 9:79165682-79165704 TAGCCTCCTAACTCCAACCAAGG + Intergenic
1056784338 9:89579331-89579353 AAGCAAACACACACAAACCATGG + Intergenic
1058590261 9:106557931-106557953 AAGCCACCTCACATCAGCCAGGG + Intergenic
1061808146 9:133147909-133147931 AGGCCTCCTCACTCCAACCAGGG + Intronic
1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG + Intergenic
1186152856 X:6693345-6693367 AAGCCCCCTCTCCCCAACCATGG - Intergenic
1188060062 X:25590338-25590360 CACCCTACCCCCACCAACCAAGG - Intergenic
1198147232 X:133869514-133869536 AGGACTACTGACACAAACCATGG + Intronic
1200979390 Y:9248143-9248165 AAGCATACTCAGACCATGCATGG - Intergenic
1202111628 Y:21427379-21427401 AAGCATACTCAGACCATGCATGG + Intergenic
1202116816 Y:21476758-21476780 AAGCATACTCAGACCATGCATGG - Intergenic