ID: 1176335991

View in Genome Browser
Species Human (GRCh38)
Location 21:5600717-5600739
Sequence TCCCGATGTTGGGGGAGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176335991_1176335996 6 Left 1176335991 21:5600717-5600739 CCAACGCTCCCCCAACATCGGGA No data
Right 1176335996 21:5600746-5600768 AAACAAATTTCCTTTTTTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176335991 Original CRISPR TCCCGATGTTGGGGGAGCGT TGG (reversed) Intergenic
No off target data available for this crispr