ID: 1176336292

View in Genome Browser
Species Human (GRCh38)
Location 21:5602767-5602789
Sequence TAGCGCACTGTCACTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176336292_1176336295 -6 Left 1176336292 21:5602767-5602789 CCCAGCTCAGTGACAGTGCGCTA No data
Right 1176336295 21:5602784-5602806 GCGCTAGTCTAAGGAGAAAGAGG No data
1176336292_1176336298 17 Left 1176336292 21:5602767-5602789 CCCAGCTCAGTGACAGTGCGCTA No data
Right 1176336298 21:5602807-5602829 CAGGGCAGTGTGCGCCTTGCTGG No data
1176336292_1176336297 -1 Left 1176336292 21:5602767-5602789 CCCAGCTCAGTGACAGTGCGCTA No data
Right 1176336297 21:5602789-5602811 AGTCTAAGGAGAAAGAGGCAGGG No data
1176336292_1176336300 26 Left 1176336292 21:5602767-5602789 CCCAGCTCAGTGACAGTGCGCTA No data
Right 1176336300 21:5602816-5602838 GTGCGCCTTGCTGGGCTTCCTGG No data
1176336292_1176336301 27 Left 1176336292 21:5602767-5602789 CCCAGCTCAGTGACAGTGCGCTA No data
Right 1176336301 21:5602817-5602839 TGCGCCTTGCTGGGCTTCCTGGG No data
1176336292_1176336296 -2 Left 1176336292 21:5602767-5602789 CCCAGCTCAGTGACAGTGCGCTA No data
Right 1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG No data
1176336292_1176336299 18 Left 1176336292 21:5602767-5602789 CCCAGCTCAGTGACAGTGCGCTA No data
Right 1176336299 21:5602808-5602830 AGGGCAGTGTGCGCCTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176336292 Original CRISPR TAGCGCACTGTCACTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr