ID: 1176336296

View in Genome Browser
Species Human (GRCh38)
Location 21:5602788-5602810
Sequence TAGTCTAAGGAGAAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176336291_1176336296 9 Left 1176336291 21:5602756-5602778 CCTAGCATGCACCCAGCTCAGTG No data
Right 1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG No data
1176336293_1176336296 -3 Left 1176336293 21:5602768-5602790 CCAGCTCAGTGACAGTGCGCTAG No data
Right 1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG No data
1176336292_1176336296 -2 Left 1176336292 21:5602767-5602789 CCCAGCTCAGTGACAGTGCGCTA No data
Right 1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176336296 Original CRISPR TAGTCTAAGGAGAAAGAGGC AGG Intergenic
No off target data available for this crispr