ID: 1176336629

View in Genome Browser
Species Human (GRCh38)
Location 21:5604873-5604895
Sequence CAGCTTCAGAATTCTGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176336624_1176336629 -3 Left 1176336624 21:5604853-5604875 CCACGTGGCCTGCTTATGAACAG No data
Right 1176336629 21:5604873-5604895 CAGCTTCAGAATTCTGTAGGGGG No data
1176336622_1176336629 29 Left 1176336622 21:5604821-5604843 CCTCATGCTCAACAGCTTTTGAG No data
Right 1176336629 21:5604873-5604895 CAGCTTCAGAATTCTGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176336629 Original CRISPR CAGCTTCAGAATTCTGTAGG GGG Intergenic
No off target data available for this crispr