ID: 1176339007

View in Genome Browser
Species Human (GRCh38)
Location 21:5626201-5626223
Sequence TCTCTGAGTAGACCAATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176339005_1176339007 7 Left 1176339005 21:5626171-5626193 CCTCCAAGACTAAACGAGGAAGA No data
Right 1176339007 21:5626201-5626223 TCTCTGAGTAGACCAATAGCAGG No data
1176339006_1176339007 4 Left 1176339006 21:5626174-5626196 CCAAGACTAAACGAGGAAGAAGT 0: 63
1: 8146
2: 3955
3: 2093
4: 2188
Right 1176339007 21:5626201-5626223 TCTCTGAGTAGACCAATAGCAGG No data
1176339003_1176339007 12 Left 1176339003 21:5626166-5626188 CCACACCTCCAAGACTAAACGAG No data
Right 1176339007 21:5626201-5626223 TCTCTGAGTAGACCAATAGCAGG No data
1176339002_1176339007 23 Left 1176339002 21:5626155-5626177 CCTGGAAACATCCACACCTCCAA No data
Right 1176339007 21:5626201-5626223 TCTCTGAGTAGACCAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176339007 Original CRISPR TCTCTGAGTAGACCAATAGC AGG Intergenic
No off target data available for this crispr