ID: 1176340254

View in Genome Browser
Species Human (GRCh38)
Location 21:5687130-5687152
Sequence TTGCAGCCCTACCACTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176340254_1176340255 5 Left 1176340254 21:5687130-5687152 CCTTTTCAGTGGTAGGGCTGCAA No data
Right 1176340255 21:5687158-5687180 AGTATTTTAGCGTTAGCCTTTGG No data
1176340254_1176340256 13 Left 1176340254 21:5687130-5687152 CCTTTTCAGTGGTAGGGCTGCAA No data
Right 1176340256 21:5687166-5687188 AGCGTTAGCCTTTGGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176340254 Original CRISPR TTGCAGCCCTACCACTGAAA AGG (reversed) Intergenic
No off target data available for this crispr