ID: 1176340415

View in Genome Browser
Species Human (GRCh38)
Location 21:5689274-5689296
Sequence TCTCTGAGTAGACCAATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176340414_1176340415 4 Left 1176340414 21:5689247-5689269 CCAAGACTAAACGAGGAAGAAGT 0: 63
1: 8146
2: 3955
3: 2093
4: 2188
Right 1176340415 21:5689274-5689296 TCTCTGAGTAGACCAATAGCAGG No data
1176340413_1176340415 7 Left 1176340413 21:5689244-5689266 CCTCCAAGACTAAACGAGGAAGA No data
Right 1176340415 21:5689274-5689296 TCTCTGAGTAGACCAATAGCAGG No data
1176340411_1176340415 12 Left 1176340411 21:5689239-5689261 CCACACCTCCAAGACTAAACGAG No data
Right 1176340415 21:5689274-5689296 TCTCTGAGTAGACCAATAGCAGG No data
1176340410_1176340415 23 Left 1176340410 21:5689228-5689250 CCTGGAAACATCCACACCTCCAA No data
Right 1176340415 21:5689274-5689296 TCTCTGAGTAGACCAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176340415 Original CRISPR TCTCTGAGTAGACCAATAGC AGG Intergenic
No off target data available for this crispr