ID: 1176344266

View in Genome Browser
Species Human (GRCh38)
Location 21:5727444-5727466
Sequence GTCAGGTTACCTACAAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176344266_1176344271 25 Left 1176344266 21:5727444-5727466 CCTCCATTTGTAGGTAACCTGAC No data
Right 1176344271 21:5727492-5727514 TATTTCCTTCATTTCAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176344266 Original CRISPR GTCAGGTTACCTACAAATGG AGG (reversed) Intergenic
No off target data available for this crispr