ID: 1176344268

View in Genome Browser
Species Human (GRCh38)
Location 21:5727461-5727483
Sequence GGCAGACAGAGAGAGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176344268_1176344271 8 Left 1176344268 21:5727461-5727483 CCTGACTTCTCTCTCTGTCTGCC No data
Right 1176344271 21:5727492-5727514 TATTTCCTTCATTTCAACCTTGG No data
1176344268_1176344273 17 Left 1176344268 21:5727461-5727483 CCTGACTTCTCTCTCTGTCTGCC No data
Right 1176344273 21:5727501-5727523 CATTTCAACCTTGGAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176344268 Original CRISPR GGCAGACAGAGAGAGAAGTC AGG (reversed) Intergenic