ID: 1176344271

View in Genome Browser
Species Human (GRCh38)
Location 21:5727492-5727514
Sequence TATTTCCTTCATTTCAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176344266_1176344271 25 Left 1176344266 21:5727444-5727466 CCTCCATTTGTAGGTAACCTGAC No data
Right 1176344271 21:5727492-5727514 TATTTCCTTCATTTCAACCTTGG No data
1176344268_1176344271 8 Left 1176344268 21:5727461-5727483 CCTGACTTCTCTCTCTGTCTGCC No data
Right 1176344271 21:5727492-5727514 TATTTCCTTCATTTCAACCTTGG No data
1176344267_1176344271 22 Left 1176344267 21:5727447-5727469 CCATTTGTAGGTAACCTGACTTC No data
Right 1176344271 21:5727492-5727514 TATTTCCTTCATTTCAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176344271 Original CRISPR TATTTCCTTCATTTCAACCT TGG Intergenic
No off target data available for this crispr