ID: 1176346592 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:5753996-5754018 |
Sequence | TCTCCTCTTTGGCCTCCTAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1176346589_1176346592 | 13 | Left | 1176346589 | 21:5753960-5753982 | CCTGAGTCAAGGCTTCTTTGATT | No data | ||
Right | 1176346592 | 21:5753996-5754018 | TCTCCTCTTTGGCCTCCTAGAGG | No data | ||||
1176346587_1176346592 | 26 | Left | 1176346587 | 21:5753947-5753969 | CCTAAAGCTGGGGCCTGAGTCAA | No data | ||
Right | 1176346592 | 21:5753996-5754018 | TCTCCTCTTTGGCCTCCTAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1176346592 | Original CRISPR | TCTCCTCTTTGGCCTCCTAG AGG | Intergenic | ||