ID: 1176346592

View in Genome Browser
Species Human (GRCh38)
Location 21:5753996-5754018
Sequence TCTCCTCTTTGGCCTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176346589_1176346592 13 Left 1176346589 21:5753960-5753982 CCTGAGTCAAGGCTTCTTTGATT No data
Right 1176346592 21:5753996-5754018 TCTCCTCTTTGGCCTCCTAGAGG No data
1176346587_1176346592 26 Left 1176346587 21:5753947-5753969 CCTAAAGCTGGGGCCTGAGTCAA No data
Right 1176346592 21:5753996-5754018 TCTCCTCTTTGGCCTCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176346592 Original CRISPR TCTCCTCTTTGGCCTCCTAG AGG Intergenic