ID: 1176349617

View in Genome Browser
Species Human (GRCh38)
Location 21:5782119-5782141
Sequence CAACTAGGATTGGTGTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176349617_1176349623 13 Left 1176349617 21:5782119-5782141 CCTTGCTACACCAATCCTAGTTG No data
Right 1176349623 21:5782155-5782177 ACCATATGCATGTTGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176349617 Original CRISPR CAACTAGGATTGGTGTAGCA AGG (reversed) Intergenic
No off target data available for this crispr