ID: 1176349679

View in Genome Browser
Species Human (GRCh38)
Location 21:5782569-5782591
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176349670_1176349679 -1 Left 1176349670 21:5782547-5782569 CCCCATCTTCTGGTAACATGCCC No data
Right 1176349679 21:5782569-5782591 CAGGACCCATAACATGGGCAGGG No data
1176349671_1176349679 -2 Left 1176349671 21:5782548-5782570 CCCATCTTCTGGTAACATGCCCA No data
Right 1176349679 21:5782569-5782591 CAGGACCCATAACATGGGCAGGG No data
1176349672_1176349679 -3 Left 1176349672 21:5782549-5782571 CCATCTTCTGGTAACATGCCCAG No data
Right 1176349679 21:5782569-5782591 CAGGACCCATAACATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176349679 Original CRISPR CAGGACCCATAACATGGGCA GGG Intergenic
No off target data available for this crispr