ID: 1176351080

View in Genome Browser
Species Human (GRCh38)
Location 21:5848028-5848050
Sequence GTCAGGTTACCTACAAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176351080_1176351085 25 Left 1176351080 21:5848028-5848050 CCTCCATTTGTAGGTAACCTGAC No data
Right 1176351085 21:5848076-5848098 TATTTCCTTCATTTCAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176351080 Original CRISPR GTCAGGTTACCTACAAATGG AGG (reversed) Intergenic
No off target data available for this crispr