ID: 1176356431

View in Genome Browser
Species Human (GRCh38)
Location 21:5902703-5902725
Sequence CAACTAGGATTGGTGTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176356431_1176356437 13 Left 1176356431 21:5902703-5902725 CCTTGCTACACCAATCCTAGTTG No data
Right 1176356437 21:5902739-5902761 ACCATATGCATGTTGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176356431 Original CRISPR CAACTAGGATTGGTGTAGCA AGG (reversed) Intergenic
No off target data available for this crispr