ID: 1176356493

View in Genome Browser
Species Human (GRCh38)
Location 21:5903153-5903175
Sequence CAGGACCCATAACATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176356486_1176356493 -3 Left 1176356486 21:5903133-5903155 CCATCTTCTGGTAACATGCCCAG No data
Right 1176356493 21:5903153-5903175 CAGGACCCATAACATGGGCAGGG No data
1176356485_1176356493 -2 Left 1176356485 21:5903132-5903154 CCCATCTTCTGGTAACATGCCCA No data
Right 1176356493 21:5903153-5903175 CAGGACCCATAACATGGGCAGGG No data
1176356484_1176356493 -1 Left 1176356484 21:5903131-5903153 CCCCATCTTCTGGTAACATGCCC No data
Right 1176356493 21:5903153-5903175 CAGGACCCATAACATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176356493 Original CRISPR CAGGACCCATAACATGGGCA GGG Intergenic
No off target data available for this crispr