ID: 1176358681

View in Genome Browser
Species Human (GRCh38)
Location 21:5974136-5974158
Sequence CACAGGGGTGGAGCTACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2591
Summary {0: 10, 1: 228, 2: 487, 3: 783, 4: 1083}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176358671_1176358681 17 Left 1176358671 21:5974096-5974118 CCATGAAAGCAGCCAGGAGAGGG 0: 30
1: 166
2: 534
3: 723
4: 977
Right 1176358681 21:5974136-5974158 CACAGGGGTGGAGCTACCCAAGG 0: 10
1: 228
2: 487
3: 783
4: 1083
1176358674_1176358681 5 Left 1176358674 21:5974108-5974130 CCAGGAGAGGGGCTATACCTTGC 0: 3
1: 20
2: 97
3: 375
4: 903
Right 1176358681 21:5974136-5974158 CACAGGGGTGGAGCTACCCAAGG 0: 10
1: 228
2: 487
3: 783
4: 1083
1176358669_1176358681 18 Left 1176358669 21:5974095-5974117 CCCATGAAAGCAGCCAGGAGAGG 0: 28
1: 201
2: 627
3: 1035
4: 1310
Right 1176358681 21:5974136-5974158 CACAGGGGTGGAGCTACCCAAGG 0: 10
1: 228
2: 487
3: 783
4: 1083
1176358666_1176358681 30 Left 1176358666 21:5974083-5974105 CCTCAATGCCAGCCCATGAAAGC 0: 14
1: 11
2: 25
3: 36
4: 194
Right 1176358681 21:5974136-5974158 CACAGGGGTGGAGCTACCCAAGG 0: 10
1: 228
2: 487
3: 783
4: 1083
1176358668_1176358681 22 Left 1176358668 21:5974091-5974113 CCAGCCCATGAAAGCAGCCAGGA 0: 350
1: 579
2: 976
3: 1101
4: 1218
Right 1176358681 21:5974136-5974158 CACAGGGGTGGAGCTACCCAAGG 0: 10
1: 228
2: 487
3: 783
4: 1083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176358681 Original CRISPR CACAGGGGTGGAGCTACCCA AGG Intergenic
Too many off-targets to display for this crispr