ID: 1176359461

View in Genome Browser
Species Human (GRCh38)
Location 21:5982828-5982850
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 2, 1: 0, 2: 0, 3: 25, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176359456_1176359461 -6 Left 1176359456 21:5982811-5982833 CCTGCAGGTGGCACATATGGGTG 0: 2
1: 0
2: 7
3: 36
4: 184
Right 1176359461 21:5982828-5982850 TGGGTGGGTCGCAGCGGTGGTGG 0: 2
1: 0
2: 0
3: 25
4: 265
1176359453_1176359461 1 Left 1176359453 21:5982804-5982826 CCTTGGACCTGCAGGTGGCACAT 0: 2
1: 0
2: 2
3: 24
4: 216
Right 1176359461 21:5982828-5982850 TGGGTGGGTCGCAGCGGTGGTGG 0: 2
1: 0
2: 0
3: 25
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176359461 Original CRISPR TGGGTGGGTCGCAGCGGTGG TGG Intergenic
901529526 1:9844396-9844418 TGGGAGGGTGGCTGCTGTGGGGG - Intergenic
903738359 1:25544201-25544223 TGGCTGGGGCGCAGGGGTGCGGG - Intronic
906573211 1:46862480-46862502 CGGGTGGGTGCCAGCTGTGGTGG - Intergenic
906598656 1:47104608-47104630 TGGGTGGATACCAGCTGTGGTGG + Intronic
909409270 1:75330314-75330336 TGGTGGGGTGGCAGTGGTGGTGG - Intronic
911022914 1:93407235-93407257 TGCGTGGGTATCAGCAGTGGAGG + Intergenic
912002588 1:104853652-104853674 TGGGGGGGCCGCAGTGGTAGGGG + Intergenic
913029939 1:114892024-114892046 TGGGTGAGTGCCAGCTGTGGTGG + Intronic
913444295 1:118933440-118933462 TGGGTGGGGGGCAGAGGGGGAGG - Intronic
915493680 1:156266237-156266259 TGGGTGGGTGGCGGCGACGGCGG + Exonic
915726487 1:158021732-158021754 TGGGGGTGTGGCAGCTGTGGTGG + Intronic
916169277 1:161988544-161988566 TGGGTGGGTGTCAGCGGGGGTGG - Intronic
917028186 1:170664191-170664213 GGGGTGGGTGGGATCGGTGGGGG + Exonic
917178102 1:172261767-172261789 TGGTTGGGTGCCAGCTGTGGTGG + Intronic
921592917 1:217024478-217024500 TGGGTGGGTGGCTGTGGAGGGGG - Intronic
923644821 1:235808423-235808445 TGTGTGGGTGGCGGCGGGGGCGG - Intronic
1063221700 10:3975041-3975063 TGTGGGGGTCGCAGGGATGGTGG + Intergenic
1064243940 10:13654706-13654728 TGGGTGGGATGCAGAGGTTGGGG - Intronic
1068395571 10:56457002-56457024 TGGGTTGGTTCCAGCTGTGGTGG - Intergenic
1068700119 10:60010617-60010639 TGGGTGTGTAGCAGAGATGGAGG - Intergenic
1070275375 10:75001047-75001069 TGTGTGGGGGGCAGGGGTGGAGG - Intronic
1070655860 10:78270744-78270766 TGTGTGGGTGGCAGCTGTGTTGG + Intergenic
1071268915 10:83989278-83989300 TGGGTGGGTGGTAGAGGGGGAGG - Intergenic
1071366460 10:84905357-84905379 TAGGTGGGGTGCAGCAGTGGTGG + Intergenic
1073075724 10:100824998-100825020 TGGGTGGGTGGGCGCTGTGGAGG - Intronic
1075087545 10:119423570-119423592 CGGGTTGGTGGCAGTGGTGGGGG - Intronic
1075093643 10:119457200-119457222 TGGATGGGTGGCTGGGGTGGTGG - Intronic
1076143152 10:128095716-128095738 TGTGGGGGTGGCAGCGGGGGAGG + Intergenic
1076765847 10:132632600-132632622 TGGGCGGGGTGCAGTGGTGGTGG - Intronic
1077673508 11:4178904-4178926 TGTGTGGGTGTCAGCTGTGGTGG + Intergenic
1078446282 11:11407430-11407452 AGGCTGTGTCTCAGCGGTGGTGG - Intronic
1079078004 11:17395580-17395602 TGGGTGGGCCTGAGGGGTGGTGG + Intronic
1082800519 11:57410775-57410797 TGGGTGGGACCCAGTGGGGGAGG + Intronic
1083265898 11:61546745-61546767 TCGGTGGTTCGTGGCGGTGGTGG - Intronic
1084028230 11:66466370-66466392 GGGGTGTGCGGCAGCGGTGGAGG - Intronic
1085222681 11:74888284-74888306 TGCCTGGGTATCAGCGGTGGAGG - Intronic
1086306599 11:85486604-85486626 TGTGTGGGTGTCAGCTGTGGTGG - Intronic
1087951565 11:104227154-104227176 GGGGTGGATGGCAGGGGTGGGGG + Intergenic
1089334509 11:117713806-117713828 TGGGTGGTGGGCAGTGGTGGTGG + Intronic
1089346944 11:117796889-117796911 CGGGTGGGGCGCAGCGGGGAGGG - Intronic
1089514518 11:119023865-119023887 TGGGGTGGTGGCAGCAGTGGTGG + Exonic
1090453069 11:126823584-126823606 TTGGTGGGTCCCTGCAGTGGGGG + Intronic
1090473662 11:127001297-127001319 TGGGTGGGTGGTTGTGGTGGGGG + Intronic
1091861859 12:3792630-3792652 TTGGTGGGGGGCAGCGGGGGAGG - Intronic
1092009305 12:5096369-5096391 TGTGTGTGTTGCAGGGGTGGTGG + Intergenic
1094063816 12:26342480-26342502 TGTTTGGGTCACGGCGGTGGGGG + Intronic
1097042376 12:56163602-56163624 GGGGAGGGTCCCAGTGGTGGGGG + Exonic
1097664807 12:62466745-62466767 GGGGTTGGCCGCGGCGGTGGCGG + Intergenic
1097990084 12:65824989-65825011 TGGGTGGGTGCCGGAGGTGGAGG - Exonic
1098585013 12:72144277-72144299 TGGGTGGATTGCAGAGGAGGGGG - Intronic
1100946990 12:99796397-99796419 TGGGTGGGCGGCAGGGGTAGGGG + Intronic
1101413468 12:104488851-104488873 TGGGTGGCTCGCAGTTCTGGAGG + Intronic
1101592812 12:106138950-106138972 AGGGTGGCTCGCAGCGCAGGAGG + Exonic
1101843295 12:108342647-108342669 TGGGTGGCTGGCAGAGGAGGTGG + Intergenic
1102046399 12:109832786-109832808 GGGGTGGGTAGCGGGGGTGGGGG - Intronic
1102441950 12:112970263-112970285 TGGGTGGGAAGCAGCAGTGGTGG - Exonic
1102515013 12:113440532-113440554 CTGGTGGGTGGCAGAGGTGGCGG - Intergenic
1103237610 12:119386323-119386345 TGGGTAGGTTGCAGGGGTGGAGG + Intronic
1103424727 12:120823222-120823244 TGGGGGGGCGGCGGCGGTGGCGG + Intronic
1104881198 12:132071669-132071691 TGGGTGGGTCGGGGGTGTGGGGG + Intronic
1104987860 12:132607158-132607180 TGGGCCGGTCGCTGTGGTGGGGG - Intronic
1112306221 13:98276824-98276846 AGTGTGGGTGGCAGGGGTGGAGG - Intronic
1113311757 13:109139960-109139982 TGGGTGGGTAGCAGCAGAAGTGG + Intronic
1114500018 14:23161599-23161621 TGGGTGGGTGGGAGGGGTGCTGG + Intronic
1116625927 14:47263305-47263327 AGGATGGGTGGCAGTGGTGGGGG - Intronic
1117281004 14:54241038-54241060 TGTGTGTGTGGCAGTGGTGGCGG - Intergenic
1117744924 14:58860130-58860152 TGGGTGGGTATCAGCTGTGGTGG + Intergenic
1119859194 14:77924327-77924349 TCGGTGGGCCGGAGCGGTTGTGG - Intronic
1120067535 14:80060981-80061003 TGGGTGGGTGGCTGCTGTGATGG + Intergenic
1120740653 14:88105819-88105841 TGCGTGGGTGTCAGCTGTGGTGG + Intergenic
1120994510 14:90406626-90406648 GGGGTGGGTCAGAGCAGTGGAGG + Exonic
1121174761 14:91882831-91882853 TGGGAAGGTGGCAGGGGTGGGGG - Intronic
1128466587 15:67917818-67917840 TGGGCGGGATGCAGAGGTGGGGG + Intergenic
1128627256 15:69222318-69222340 TGGGTGGGAGGCAGGGGTGGTGG + Intronic
1129070536 15:72946640-72946662 TGGGTGGGTATCAGCAGTGGTGG - Intergenic
1131144352 15:90001702-90001724 GGGGTGGGTCGCTGCGGCCGCGG + Intronic
1131174389 15:90201109-90201131 TGGGAGGGTCTGAGCAGTGGGGG + Intronic
1132244794 15:100286096-100286118 TGGGCTGGTCGCGTCGGTGGAGG - Intronic
1132415478 15:101615864-101615886 TGGGAGGGTCTGAGCTGTGGTGG - Intergenic
1133030573 16:3008883-3008905 TGGGTTGGTCACTGAGGTGGGGG + Intergenic
1133156560 16:3880452-3880474 TGGGGGGGCCGCGGCGGCGGCGG - Exonic
1133769454 16:8859288-8859310 TGGGTGGGGGGCTGTGGTGGTGG + Exonic
1133818123 16:9213623-9213645 TGGGTCAGTTGCAGCGGGGGTGG + Intergenic
1135395680 16:22130039-22130061 TCAGTGGGTCTCAGCGGTGCAGG + Intronic
1137926673 16:52547207-52547229 TGGGAGGGGCGGAGCGGCGGCGG - Intronic
1137988647 16:53131072-53131094 GCGGTGGGTGGCAGCGGCGGCGG - Intronic
1139136092 16:64206249-64206271 TGGGGGGGTCGGAGTGGTGGTGG + Intergenic
1139349773 16:66327762-66327784 TGGGTGGGTGGCAGGGGTGAGGG - Intergenic
1139531790 16:67546076-67546098 TGGGAGGGTTTCAGGGGTGGGGG - Intronic
1139846463 16:69924880-69924902 TGGGGGGGACGCCGAGGTGGAGG + Intronic
1141589949 16:85061796-85061818 TGGGTGGGAAGAAGCAGTGGGGG + Intronic
1141598992 16:85114013-85114035 TGGCTGAGTCGCACCGGAGGAGG + Intergenic
1141910120 16:87053134-87053156 TGGGTGGTTCCCAGCTGGGGAGG - Intergenic
1144967549 17:19087578-19087600 TGTGTGTGTGGCAGGGGTGGGGG + Intergenic
1144980370 17:19164487-19164509 TGTGTGTGTGGCAGGGGTGGGGG - Intergenic
1144987852 17:19213745-19213767 TGTGTGTGTGGCAGGGGTGGGGG + Intergenic
1146127592 17:30241075-30241097 TAGGTGGGTCGGAGGGGAGGAGG + Intergenic
1146909983 17:36642104-36642126 AGGGCGGCTCGCTGCGGTGGTGG - Intergenic
1147322712 17:39656019-39656041 TGGGTGGGTGGCAGGCCTGGGGG + Intronic
1147380621 17:40053609-40053631 TGAGCAGGTGGCAGCGGTGGCGG + Exonic
1147612127 17:41808077-41808099 TGGCTGGGTAGCAGGGGTGCTGG - Intronic
1147702493 17:42404663-42404685 GGGGTGGGTGGCAGCGGGGGCGG + Exonic
1148383674 17:47219472-47219494 TGTGTGGGTGGGAGGGGTGGAGG + Intronic
1148388504 17:47253743-47253765 TGGGTGGGACGCAACGGGGCGGG - Intergenic
1149496085 17:57118456-57118478 TGTGTGGTTGGCAGGGGTGGGGG + Intronic
1149866549 17:60154238-60154260 GGGGTGGGTGGGAGGGGTGGGGG + Intronic
1150650973 17:67010006-67010028 TGGTTGGGTAGCAGTGATGGGGG - Intronic
1151393088 17:73801107-73801129 TGGCAGGGTGGCAGCGGTGGGGG + Intergenic
1151524268 17:74653237-74653259 TGGGTGGGATGTAGGGGTGGTGG - Intergenic
1152376699 17:79922320-79922342 TGGGTGACTTGCAGCGGGGGTGG + Intergenic
1152511522 17:80792884-80792906 TGGGGAGGGCGCAGGGGTGGCGG - Intronic
1152624026 17:81380093-81380115 AGGATGGGAGGCAGCGGTGGGGG - Intergenic
1152737659 17:82005237-82005259 AGGGTGGGGCGCCGGGGTGGCGG + Intronic
1153332361 18:3886892-3886914 TGGCTGGAACGCAGCTGTGGGGG + Intronic
1154307860 18:13243718-13243740 TGGGTGGGTCGCTGGGTGGGTGG - Intronic
1155348007 18:24877682-24877704 TGGGTGGGGGGCGGGGGTGGGGG + Intergenic
1155963902 18:32018697-32018719 AGGGTTGGGCGCAGCGGCGGAGG + Exonic
1157491856 18:48129100-48129122 TGGGCGGGTCTCAGCGGGTGGGG + Intronic
1157706799 18:49813960-49813982 TGGGCGGGGCGCGGCGGCGGCGG + Exonic
1159951426 18:74486882-74486904 TGGGTGGGTGGGTGGGGTGGGGG + Intergenic
1160679457 19:406120-406142 TGGGTGGGTCGGAGCCCAGGAGG - Exonic
1161438576 19:4278564-4278586 GGGGTGGGGGGGAGCGGTGGCGG - Intergenic
1162315493 19:9936159-9936181 GGCGGGGGTCGCAGCGGGGGAGG - Intronic
1162744748 19:12792108-12792130 CGCGGGGGTGGCAGCGGTGGAGG + Exonic
1163019868 19:14476194-14476216 TGGGTGCGTCCCGGCGCTGGGGG - Intergenic
1163167149 19:15506348-15506370 TGGGTGGGGGGTAGAGGTGGGGG - Intergenic
1163496187 19:17647804-17647826 GGGGTGGGACGCAGAGGGGGCGG - Intronic
1163721179 19:18898970-18898992 TGGGTGGGTGGCAGCAGGGCTGG - Intergenic
1165860744 19:38907936-38907958 GGGGTGGGTGGTAGCGCTGGGGG + Intronic
1166205345 19:41265349-41265371 GGGGTGGGTGGGAGAGGTGGAGG + Intronic
1166366499 19:42280916-42280938 TGGGTGGGATGCGGGGGTGGGGG - Intronic
926137477 2:10346947-10346969 TGGGTGGGTGGGTGGGGTGGTGG - Intronic
927610700 2:24536761-24536783 TGTGTGGGTCTCACCAGTGGAGG + Intronic
929673329 2:43897742-43897764 TGGGTGGGTGGCAGCAGGGATGG - Intronic
929943224 2:46351084-46351106 TGGGTGGGACAAAGGGGTGGAGG - Intronic
930339475 2:50094497-50094519 TTGGTGGGTGGCAGCGGTCAAGG + Intronic
932416919 2:71579118-71579140 TGGGTGGGAGGCGGCGGTGGTGG - Intronic
935492280 2:103735386-103735408 TGGATGGGTGCCAGCTGTGGTGG + Intergenic
937465637 2:122131050-122131072 AGGGTGGGTGCCAGCTGTGGTGG + Intergenic
941869623 2:170370603-170370625 TAGGTGGGTGGTAGGGGTGGTGG - Intronic
943276745 2:185876772-185876794 TAGGTGGGTTTCAGCTGTGGTGG - Intergenic
943333899 2:186590560-186590582 TGGGTGGGTGCGCGCGGTGGGGG - Intronic
946186363 2:217982988-217983010 GGGGTGGGTGGCATTGGTGGTGG - Intronic
947736863 2:232459657-232459679 TGGGTGGGTTGCAGGGTTGCCGG - Exonic
947841306 2:233209562-233209584 TGGGGGGGGGGCTGCGGTGGAGG - Intergenic
949040066 2:241843999-241844021 GGGGTGGGGCGCAGGGGTGGGGG + Intergenic
1168800646 20:642037-642059 TGGGGGGGGCCCAGCGGGGGTGG + Intergenic
1168800675 20:642100-642122 TGGGGGGGGCCCAGCGGGGGTGG + Intergenic
1168800741 20:642230-642252 TGGGGGGGGCCCAGCGGGGGTGG + Intergenic
1169267009 20:4172798-4172820 TGGGTGGGTGGGAGGGGGGGTGG + Intronic
1170240834 20:14164630-14164652 TGGGTGGGTGCCAGCTGTGGTGG + Intronic
1172194558 20:33083213-33083235 TTGCTGGGTGGCAGTGGTGGGGG + Intronic
1172604931 20:36207804-36207826 TGGGCGGGGAGCAGCGGTGGGGG - Intronic
1172876149 20:38165385-38165407 TGGGTGAGCCCCAGCGCTGGCGG - Intronic
1175127753 20:56764964-56764986 TGGGTGGGGGGCGGTGGTGGTGG + Intergenic
1175263747 20:57690315-57690337 AGGGCGGGTGGCAGTGGTGGGGG - Intronic
1176015528 20:62929312-62929334 TGGGAGGGGAGCAGCGGGGGAGG + Intronic
1176359461 21:5982828-5982850 TGGGTGGGTCGCAGCGGTGGTGG + Intergenic
1176973251 21:15290008-15290030 TGGGTGGGTCGGGGTGGAGGCGG + Intergenic
1179764057 21:43555722-43555744 TGGGTGGGTCGCAGCGGTGGTGG - Intronic
1180187876 21:46149110-46149132 TGGGTGGGAGGCAGGAGTGGAGG + Intronic
1181046281 22:20215826-20215848 TGGGGGGGTCACGGCGGGGGAGG + Intergenic
1181175521 22:21032632-21032654 TGGGTGTGTGGCAGCGGGTGGGG - Intronic
1181276730 22:21692029-21692051 GGGGTGGGTCCCGGCGCTGGCGG - Intronic
1183081298 22:35458383-35458405 TGGGTGGGGTGCAGAGATGGGGG + Intergenic
1183081444 22:35459133-35459155 TGGGTGGGGTGCAGAGATGGGGG + Intergenic
1183949260 22:41343578-41343600 TGGGTGGGCTGCAGCGGGGCAGG + Intronic
1184032876 22:41905125-41905147 TTGGTGGGTTGCAGGGGTTGGGG + Intronic
1184292939 22:43508017-43508039 TGGGGGGATCCCAGAGGTGGTGG + Intergenic
1184760105 22:46538788-46538810 GGGGCCGGTCGGAGCGGTGGGGG + Intergenic
1185076786 22:48687431-48687453 TGGATTGGTGGCAGGGGTGGGGG + Intronic
949208848 3:1473845-1473867 GGGGAGGGTGGGAGCGGTGGGGG + Intergenic
950200354 3:11037933-11037955 GGGGTGGGTGGCAGCGAGGGTGG - Exonic
950419866 3:12892529-12892551 TGGGGGGGGTGCAGGGGTGGGGG - Intergenic
950420008 3:12892909-12892931 TGGGTGGGGTGAAGGGGTGGGGG - Intergenic
950611289 3:14128343-14128365 TGGCTGGGTGGGAGCAGTGGAGG - Intronic
952046538 3:29328441-29328463 TGGGTGGGTGGTAGGGATGGTGG - Intronic
954054993 3:48015276-48015298 TGGGTGGGTGGGGGCGGGGGCGG + Intronic
956612258 3:71135818-71135840 TGGGTGGGTCGCTGCCGTTTTGG - Intronic
957195857 3:77066976-77066998 TGTGTGTGTTGCAGGGGTGGAGG - Intronic
958085978 3:88807603-88807625 TTGGTGGGAGGCAGAGGTGGAGG - Intergenic
958930076 3:100198755-100198777 TGGGTGGGTGCCAGCTGTGGTGG - Intergenic
960989607 3:123301914-123301936 GGGGTGGGGCGGAGCGGGGGTGG + Intronic
961592242 3:127989842-127989864 TTGGTGGGCCGCAGGGGTAGGGG + Intergenic
963794782 3:149620554-149620576 TGTGTGGGGGGGAGCGGTGGAGG - Intronic
964205767 3:154173187-154173209 TGGGGGGGTGGCAGGAGTGGAGG - Intronic
965813616 3:172615198-172615220 TGGGTGAGGGGCAGCGGTGGGGG + Intergenic
967104247 3:186242468-186242490 TGGGTGGGTGGCAGCGCAGCCGG + Intronic
967126559 3:186429657-186429679 TGGGGGGGTCGGTGGGGTGGGGG - Intergenic
967288613 3:187897619-187897641 TGGGTGGCTCTCACCTGTGGAGG + Intergenic
967944960 3:194797214-194797236 TGGGTGGATGCCAGCTGTGGTGG + Intergenic
968131239 3:196194046-196194068 TGAGTGGGAGGCAGCGGAGGGGG + Intergenic
968611153 4:1557700-1557722 TGGGTGGGTCCGGGCGGTGCAGG - Intergenic
968879170 4:3290382-3290404 AGGGTGGGTGGCAGGGGCGGGGG - Intergenic
968908367 4:3464614-3464636 TGGCTGGGTCGGGGCCGTGGTGG + Intronic
969687821 4:8686042-8686064 TGGATGGGACACAGAGGTGGGGG + Intergenic
970140798 4:12980035-12980057 TGAGTGGGTCACAGCGGGGTTGG + Intergenic
975476705 4:74831763-74831785 TGTGTGTGTTGCAGGGGTGGAGG - Intergenic
976821716 4:89214281-89214303 GGAGTGGGTGGCAGTGGTGGTGG + Intergenic
978754005 4:112284260-112284282 AGGGAGGGTAGCAGAGGTGGAGG - Intronic
981670385 4:147279678-147279700 TGGGTAGGACACAGCAGTGGTGG - Intergenic
983813466 4:172093548-172093570 TGGGTGGGACGCAGAGCAGGAGG + Intronic
985528612 5:420813-420835 TGGGTGGGTGGCTGCGTGGGTGG - Intronic
985764070 5:1767855-1767877 TGGGTGGGCTGCTGCAGTGGAGG + Intergenic
985792383 5:1937076-1937098 TGGGTGGGGCGGAGCAGTGCGGG + Intergenic
990245653 5:53860584-53860606 AGGGTGGGGGGCAGCTGTGGTGG + Intergenic
990954875 5:61331782-61331804 CTCGTGGGTCGCAGCGGGGGAGG - Intergenic
992191246 5:74294278-74294300 TGGGTAGGTCGAAGGGGTGGGGG - Intergenic
994871935 5:105362490-105362512 TGGGTGGATGCCAGCTGTGGTGG - Intergenic
996542499 5:124645499-124645521 TGTGTGGGTGGCGGTGGTGGGGG + Intronic
1000130219 5:158289971-158289993 TGGGTGGGTGGGAGTGGAGGAGG + Intergenic
1000281268 5:159784491-159784513 TGGGTGTGTGTCAGTGGTGGTGG - Intergenic
1002017502 5:176336783-176336805 TGGGTGTCTCACAGCTGTGGAGG - Exonic
1002979537 6:2122406-2122428 GGGGTGGGGGGCAGTGGTGGTGG - Intronic
1003107465 6:3227463-3227485 TGGGCGCGCCGCAGCGGAGGGGG - Intronic
1005359992 6:25023044-25023066 AGGGTGGGGGGCAGCTGTGGTGG - Intronic
1005896215 6:30181598-30181620 TGGGTGGGTGTCAGTTGTGGTGG + Intergenic
1006254239 6:32816921-32816943 TGGGTGGGTCCCCTGGGTGGTGG - Exonic
1006509576 6:34514835-34514857 TGGGGAGGAGGCAGCGGTGGAGG + Intronic
1011657317 6:89563717-89563739 TGTGTGTGTTGCAGGGGTGGGGG - Intronic
1013275822 6:108583955-108583977 TGGGTTGGTGGCAGTGGTGCTGG + Intronic
1014081093 6:117286687-117286709 TGGGTGGGTCTTAGTGGTGAGGG + Intergenic
1014140816 6:117939860-117939882 TGGTGGGGTCAGAGCGGTGGAGG + Intronic
1015644891 6:135376101-135376123 GGGGCGGGGCGCAGTGGTGGGGG + Intronic
1016597077 6:145814798-145814820 TGGGCGGGGCGCAGCGGGGCGGG - Intergenic
1017719771 6:157236293-157236315 TGGGTGGGCCGCCAGGGTGGGGG - Intergenic
1018065803 6:160124530-160124552 TGGGTGGGAAGGGGCGGTGGTGG + Intronic
1018349727 6:162943782-162943804 TAGGTGGGTGCCAGCTGTGGTGG - Intronic
1019020757 6:168915677-168915699 TGGGTGGTCCACAGTGGTGGTGG - Intergenic
1019685348 7:2378966-2378988 TGGGTGGGGGGCAGCGTTGGGGG + Intronic
1020035038 7:4959347-4959369 TGGGGGGGTGGGAGAGGTGGGGG + Intergenic
1022666577 7:32416582-32416604 TGGGTGGGTGGCAGGGGATGAGG - Intergenic
1023470000 7:40507496-40507518 TGGATGGGTAGCAGGGGTAGGGG - Intronic
1024317473 7:48035299-48035321 CGGGCGGGACGCAGCGGGGGTGG - Intergenic
1024460105 7:49650585-49650607 TGCGTGGGTATCAGCAGTGGTGG - Intergenic
1026540542 7:71276207-71276229 TGGGTGGGTAGCAGGGCAGGTGG + Intronic
1031568679 7:123330708-123330730 TGGGTGGGTGCCAGCTGTGATGG - Intergenic
1032195600 7:129786493-129786515 TGTGTGGGTTGCGGGGGTGGGGG + Intergenic
1032734975 7:134683809-134683831 TGGCAGGGTGGCGGCGGTGGGGG - Intergenic
1033572632 7:142647407-142647429 TGAGAGGGTTGCAGGGGTGGGGG - Intergenic
1034741642 7:153479140-153479162 TGAGTGGGTGCCAGCTGTGGTGG - Intergenic
1035495151 7:159318589-159318611 TGGTTGAGTGGCAGCTGTGGAGG + Intergenic
1037339751 8:17831873-17831895 TGGGAGGAGGGCAGCGGTGGAGG - Intergenic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1037834062 8:22205971-22205993 TGGGAGGGTAGCAGGAGTGGGGG + Intronic
1038225531 8:25653975-25653997 TGGGTGGGTGCCTGCTGTGGTGG + Intergenic
1042185797 8:66135228-66135250 TGAGTGGCTCCCTGCGGTGGAGG + Intronic
1042869183 8:73381905-73381927 TGGGTGGGATGCAGTGGGGGTGG + Intergenic
1044244641 8:89928458-89928480 TGGGTGGTTGGCGGCGGGGGGGG - Intergenic
1045762452 8:105626549-105626571 TGGGGGGTTGGCAGTGGTGGTGG + Intronic
1048900306 8:139031357-139031379 GGGGTGGGCTGGAGCGGTGGTGG + Intergenic
1049357729 8:142196962-142196984 TGGGAGGGTGGAGGCGGTGGAGG - Intergenic
1050377985 9:4992957-4992979 TGGGTTGGGTGCAGGGGTGGGGG - Intronic
1050552137 9:6757992-6758014 TGGGTGGGAGGCAGCGGCGAAGG - Intronic
1051012797 9:12439026-12439048 TGGGTGGCTATCAGCTGTGGTGG + Intergenic
1051201808 9:14634163-14634185 TGTGTGGGTGCCAGCTGTGGTGG - Intronic
1053008527 9:34620458-34620480 TGGGTCGGTAGTAGCGATGGCGG - Exonic
1053167255 9:35853522-35853544 TGGGTGGGTAGCAGTGCCGGCGG - Exonic
1056338544 9:85601501-85601523 TGGGTGTGTGCCAGCTGTGGTGG - Intronic
1056659615 9:88534661-88534683 TGGGCGGGGCGCAGTGGGGGAGG + Intergenic
1057151201 9:92797571-92797593 GGGGTGGGTGGCAGTGGTAGGGG + Intergenic
1057482621 9:95457242-95457264 TGGGTGGTGGGCAGAGGTGGAGG + Intronic
1057952205 9:99378065-99378087 TGGGGGGGTGGCAGTGGTGGTGG + Intergenic
1058893549 9:109381361-109381383 TAGGTGGGTCGGTGCGGGGGAGG + Intronic
1060263620 9:122096206-122096228 TGGGTGTGTGGCAGAGCTGGAGG - Intergenic
1060603726 9:124895860-124895882 TGGGTGGGTCTCTGTTGTGGAGG - Intronic
1060755721 9:126211863-126211885 TGGGTGGATGGAAGTGGTGGTGG + Intergenic
1060946130 9:127569942-127569964 TGGGTGGGTCGCAGTGCCAGGGG + Intronic
1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG + Exonic
1061666327 9:132162705-132162727 GGGGTGGCTCTAAGCGGTGGCGG - Intronic
1062095509 9:134701249-134701271 TGGGGTGGTCGCTGCGGTCGAGG - Exonic
1062385447 9:136309185-136309207 TGGGTGGGTGGCAGGGTGGGGGG + Intergenic
1062637070 9:137497138-137497160 TGGGAGGGATGCAGAGGTGGGGG + Intronic
1062733088 9:138120290-138120312 TGCGGCGGTGGCAGCGGTGGTGG - Exonic
1186434226 X:9529258-9529280 TGGGTGGGTTGCAGCAGAGATGG + Intronic
1189553414 X:42116199-42116221 TGGGTGGTTACCAGAGGTGGGGG + Intergenic
1190892950 X:54586904-54586926 TAGGTGGGTGCCAGCAGTGGTGG - Intergenic
1192759989 X:74086639-74086661 TGGGTGGGTGTCAGCTGTGATGG - Intergenic
1192790736 X:74379806-74379828 TGGGTGTGGGGCAGAGGTGGTGG + Intergenic
1193425758 X:81338466-81338488 GGGGTGGGTGGTAGGGGTGGGGG + Intergenic
1193896784 X:87124232-87124254 TGGATGGATCTCAACGGTGGGGG + Intergenic
1195570370 X:106393321-106393343 TGGGTGGGTGGAAGGGGTGGAGG - Intergenic
1196668962 X:118346039-118346061 TGGGCGGGGCGAAGAGGTGGCGG - Intergenic
1197491901 X:127128440-127128462 TGGGTGGGTGCCAGCTGAGGTGG - Intergenic
1197643452 X:128992605-128992627 TGGGTGGGTTCCAGCTGTGGTGG + Intergenic
1197965456 X:132056344-132056366 TGGGTGGGTTGCAGTGGTTCTGG + Intergenic
1198601468 X:138288515-138288537 TGAGTGGGACTCAGTGGTGGTGG - Intergenic
1199242898 X:145568969-145568991 TGCGTGGGTGCCAGTGGTGGTGG - Intergenic
1202272612 Y:23085790-23085812 TGGGTGGGTGGGAGCGGTTGGGG + Intergenic
1202293414 Y:23334892-23334914 TGGGTGGGTGGGAGCGGTTGGGG - Intergenic
1202425609 Y:24719534-24719556 TGGGTGGGTGGGAGCGGTTGGGG + Intergenic
1202445180 Y:24950551-24950573 TGGGTGGGTGGGAGCGGTTGGGG - Intergenic