ID: 1176361147

View in Genome Browser
Species Human (GRCh38)
Location 21:5997689-5997711
Sequence ATGAAGAGGCAGCAAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 833
Summary {0: 3, 1: 7, 2: 25, 3: 109, 4: 689}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176361142_1176361147 2 Left 1176361142 21:5997664-5997686 CCTGTGTGCACAGAGGGATGACC 0: 2
1: 0
2: 4
3: 26
4: 187
Right 1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG 0: 3
1: 7
2: 25
3: 109
4: 689
1176361138_1176361147 10 Left 1176361138 21:5997656-5997678 CCCAGGGGCCTGTGTGCACAGAG 0: 2
1: 0
2: 3
3: 29
4: 325
Right 1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG 0: 3
1: 7
2: 25
3: 109
4: 689
1176361139_1176361147 9 Left 1176361139 21:5997657-5997679 CCAGGGGCCTGTGTGCACAGAGG 0: 2
1: 1
2: 10
3: 80
4: 436
Right 1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG 0: 3
1: 7
2: 25
3: 109
4: 689
1176361137_1176361147 11 Left 1176361137 21:5997655-5997677 CCCCAGGGGCCTGTGTGCACAGA 0: 2
1: 0
2: 4
3: 33
4: 297
Right 1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG 0: 3
1: 7
2: 25
3: 109
4: 689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176361147 Original CRISPR ATGAAGAGGCAGCAAGAGGG TGG Intergenic
900434257 1:2620699-2620721 ATGAGGACACAGCAAGAAGGTGG + Intronic
900474926 1:2871664-2871686 ATGAAGAGGCTGTGAGAGGTGGG - Intergenic
900533257 1:3165089-3165111 ATGAAGGGCCAGGCAGAGGGGGG - Intronic
900767002 1:4512524-4512546 ATGAAGAGACAGAAAGAGATGGG + Intergenic
900844518 1:5086034-5086056 ATGAGCATGCAGCAAGAAGGTGG + Intergenic
901003630 1:6161167-6161189 ATGAGGAGGCAGCAAAGGCGGGG + Intronic
901151518 1:7106339-7106361 AAGAAGAGGGAGCAAAAGAGAGG + Intronic
901527914 1:9835685-9835707 CTGAAGGGGCAGCAGGAGGGAGG + Intergenic
901637793 1:10678399-10678421 AGGGAGAGGCAGCAGGTGGGTGG + Intronic
902099207 1:13971856-13971878 AGGAAGCAGGAGCAAGAGGGAGG - Intergenic
902183186 1:14705148-14705170 GGGAAGAGGCAGCAAGAGGGAGG - Intronic
902381590 1:16055405-16055427 GTGGAGAGACAGCCAGAGGGAGG - Intronic
902652806 1:17847496-17847518 AGGCAGAGGCAGCAAGGAGGAGG - Intergenic
902660891 1:17902759-17902781 GTGAAGACACAGCAAGAAGGTGG + Intergenic
903479163 1:23640437-23640459 GTGAGGACCCAGCAAGAGGGTGG + Exonic
903557475 1:24204198-24204220 ACCAAGAGGCAGTAAGAGGTGGG + Intergenic
903650089 1:24916884-24916906 AGGACGAGGCAACAAGAGGGAGG - Intronic
904360565 1:29968714-29968736 AAGCAGAGGCAGCAGGAGGTGGG + Intergenic
904770223 1:32876982-32877004 AGGCAGAGGCAGCAAGATGCAGG - Intergenic
905506544 1:38484602-38484624 ATGACGAGGCAGCCAGTGAGGGG + Intergenic
905838495 1:41152006-41152028 TAGAAGAGGCAGAAAGTGGGTGG + Intronic
905955017 1:41985463-41985485 GTGAAGACACAGCAAGAAGGTGG - Intronic
906376344 1:45299681-45299703 ATGAATGGGAAGCAAGAGGCAGG - Intronic
906519360 1:46458159-46458181 AAGAACAGGCAGCAAGAGCCTGG - Intergenic
906543600 1:46606369-46606391 AGGAAGAGGCAGCAGAATGGAGG + Intronic
906659165 1:47570486-47570508 ATGAAGCTGCAGCCACAGGGAGG - Intergenic
906815738 1:48876408-48876430 ATCAAGAGGCAGCGAGAGGAAGG + Intronic
907228853 1:52976064-52976086 ATGAAGAGGCATATAGAGTGAGG + Intronic
907305894 1:53513061-53513083 ATGAAGAGGCAGCCTGAAGGGGG - Intronic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
908168653 1:61483556-61483578 ATGAAGATGTAGCGAGAAGGTGG - Intergenic
908199600 1:61780601-61780623 AGGCAGAGGCAGGAGGAGGGAGG - Intronic
908324661 1:63012049-63012071 ATGGAGAGGTAGGAAGAGGGAGG - Intergenic
908331726 1:63077397-63077419 GTGAAGACACAGCAAGAAGGTGG + Intergenic
908838215 1:68249995-68250017 GTGAAGAGACAGCAAGAGGGTGG - Intergenic
908949383 1:69541214-69541236 ATGAAAAGGCAGAAAGATGAGGG - Intergenic
909116297 1:71541422-71541444 ATGAAAAGGCAGCTTGAGGGTGG + Intronic
909409178 1:75329233-75329255 AGGGAAAGGAAGCAAGAGGGAGG - Intronic
909593372 1:77377416-77377438 CTGAAGAGACATCAAGAGGTTGG - Intronic
911233365 1:95383607-95383629 ATGAAGAGGGAGAGAGAGAGAGG + Intergenic
911595332 1:99793289-99793311 ATGAAGACACAGCAAGATGGTGG - Intergenic
911745103 1:101433155-101433177 ATGAGGAGTGAGAAAGAGGGAGG + Intergenic
912131542 1:106608290-106608312 GTGAAGACACAGCAAGAAGGTGG - Intergenic
912164779 1:107030202-107030224 TGAAAGCGGCAGCAAGAGGGTGG - Intergenic
912703404 1:111895048-111895070 AGGGAGAGGAAGCATGAGGGAGG + Intronic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
915599657 1:156914190-156914212 ATGATGTGGCATCAAGAGTGAGG + Intronic
916105769 1:161430437-161430459 ATGATGAGGCAGAAAAAAGGTGG + Intergenic
917311987 1:173688375-173688397 AGGAAGAGGCAGAGAGAGAGAGG - Intergenic
917311993 1:173688429-173688451 AGGAAGAGGCAGAGAGAGAGAGG - Intergenic
917311999 1:173688477-173688499 AGGAAGAGGCAGAGAGAGAGAGG - Intergenic
918044726 1:180935089-180935111 ATGAAGAGACAGGAGGAGAGAGG - Intronic
918120767 1:181537665-181537687 ATGATGATGAAGCATGAGGGTGG + Intronic
918177765 1:182060439-182060461 ATGAAGAGGGAGCAGTATGGAGG + Intronic
918290151 1:183099591-183099613 ATGAGGGGGCAGCCAGAGGGAGG - Intronic
918371354 1:183864685-183864707 ATGAAGAGGAAAAGAGAGGGTGG + Intronic
918374795 1:183898179-183898201 CGGAAGAGACTGCAAGAGGGAGG - Intronic
918394046 1:184095712-184095734 ATGAGGACACAGCAAGAAGGTGG + Intergenic
918743339 1:188165498-188165520 ATGAAGACACAGCAAGAAGGTGG - Intergenic
919657126 1:200208163-200208185 GTGAAGAAGCAGCAAGAAGGCGG + Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
921123291 1:212155239-212155261 GTGAAGACACAGCAAGAAGGTGG + Intergenic
921180153 1:212625677-212625699 CTGAGGAGCCAGCAACAGGGGGG + Exonic
921557086 1:216611900-216611922 ATGAAGAAGCAGAAATATGGAGG + Intronic
922010154 1:221575365-221575387 AGGAAGAGGAAGAAAGAAGGTGG + Intergenic
922433207 1:225576729-225576751 ATGAAGAGGCAGCAAGAGGGCGG + Intronic
922499543 1:226086359-226086381 ATGGAGAGACAGCCAGATGGAGG - Intergenic
922824015 1:228504568-228504590 ATGCAGAGACACCCAGAGGGAGG + Intergenic
922883718 1:229002201-229002223 AGAAAGAGGGAGCAAGAGGGCGG + Intergenic
922904999 1:229167614-229167636 ACGAAGAGAGAGGAAGAGGGAGG + Intergenic
923216816 1:231856266-231856288 ATGAAGAGGCAGGAAGAAGGTGG + Intronic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923556886 1:235008103-235008125 AGGAAGAGGCAGCAGGAGATGGG - Intergenic
923929176 1:238674101-238674123 TTGAAGAGACAGCCAGAAGGTGG + Intergenic
924577408 1:245292870-245292892 ATGAACTGTCAGCCAGAGGGTGG - Intronic
924808174 1:247378358-247378380 GTGAGGACACAGCAAGAGGGTGG + Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063440793 10:6071420-6071442 AGGAAGAGGAAGGAGGAGGGAGG - Intergenic
1063823366 10:9863835-9863857 GTGAAGCGGCAACAGGAGGGTGG + Intergenic
1064116985 10:12586660-12586682 GTGAGGGGGCAGCAGGAGGGTGG - Intronic
1064127649 10:12677579-12677601 ATTAAGAGTCAGCCAGATGGAGG + Intronic
1064379918 10:14832323-14832345 AAGTAGAGGGAGCAAGAGGGAGG + Intronic
1065181961 10:23135539-23135561 ATGAAGAGGCATCAGAAAGGAGG + Intergenic
1065199893 10:23302421-23302443 ATGAAGAGGCAGAGACAGGGTGG - Intronic
1065416121 10:25488202-25488224 TTGAAGAGGCAGCAGGAAAGGGG + Intronic
1066004569 10:31134383-31134405 CTGAAGAGGCAGCTGGAGCGCGG - Intergenic
1066262592 10:33743807-33743829 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1066269461 10:33808282-33808304 ATGAAAAGGCTGGGAGAGGGAGG - Intergenic
1066664956 10:37773659-37773681 GTGAAGAGACAGTAAGAGGATGG - Intergenic
1067016937 10:42764246-42764268 AGGAAGAGAGAGCAAAAGGGGGG + Intergenic
1067461510 10:46461790-46461812 ATGCAGAGGCAGCCAGAGCACGG + Exonic
1067625684 10:47922811-47922833 ATGCAGAGGCAGCCAGAGCACGG - Intergenic
1067696918 10:48542485-48542507 AGGCAGAGGCAGCAGGAGGCAGG - Intronic
1068071630 10:52203973-52203995 ATGAAGAGGCACCAAGCGACAGG - Intronic
1068390689 10:56392375-56392397 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1068874784 10:61984543-61984565 ATGTGGAGGCAGCAGGTGGGGGG + Intronic
1069214566 10:65803645-65803667 AAGAAGAGGGAGCAGGAGAGTGG - Intergenic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1069963365 10:72092495-72092517 ACGAAGACACAGCAAGAAGGCGG - Intergenic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070504839 10:77103993-77104015 ATGGAGAGGCAGCAGGACGCAGG + Intronic
1070840498 10:79484104-79484126 AAGAAAAGGAAGCCAGAGGGTGG + Intergenic
1071380286 10:85052647-85052669 AGGTAGAGGTAGCAAGAGCGAGG + Intergenic
1071767993 10:88690439-88690461 TTGAAAATGCAGCCAGAGGGTGG + Intergenic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1072826988 10:98617143-98617165 ATGAAGATGCTGCTAGATGGAGG - Intronic
1072905336 10:99447961-99447983 ATGTGGAGGCAGCTAGAGGCAGG - Intergenic
1073006032 10:100325431-100325453 AGGAAGAGGCAGGTAGAGGCAGG + Intronic
1073082052 10:100866588-100866610 ATGAGGAGGAAGCAAGAGTGAGG + Intergenic
1073150457 10:101307806-101307828 AGGAAGAGGAGGCAAGAGGTGGG + Intergenic
1073488906 10:103839689-103839711 ATGTTGAGGCAGCCAGTGGGAGG - Intronic
1073759828 10:106617284-106617306 AGGAGGAGGCAGAAGGAGGGAGG - Intronic
1074527925 10:114277854-114277876 ATGAGGGGGCAGGAGGAGGGTGG + Intronic
1074994979 10:118748948-118748970 AAGAAGAGTCAGGAGGAGGGAGG + Intronic
1075062286 10:119265526-119265548 ATGAGGACGCAGTAAGAAGGTGG + Intronic
1075299787 10:121311797-121311819 ATAAACAGGCATCAAGAGGCTGG + Intergenic
1075378882 10:122002129-122002151 ATGAGGATACAGCAAGAAGGTGG - Intronic
1075455689 10:122583403-122583425 AGGAAGAGAGAGCAAGAGGGAGG + Intronic
1075457812 10:122596106-122596128 AGGAAGAGAGAGCAAGAGGGAGG + Intronic
1075546199 10:123356709-123356731 ATGAAGACAAAGCAAGTGGGAGG - Intergenic
1075832956 10:125427148-125427170 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1075990867 10:126837512-126837534 AGGAAGAGGCAGCACCAAGGGGG - Intergenic
1076038307 10:127220301-127220323 ATGAAGAGGAGGCAGGAGTGGGG + Intronic
1076238479 10:128884051-128884073 GTGAAGAGGCAGAGAAAGGGGGG - Intergenic
1076252394 10:128994764-128994786 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1076426178 10:130369256-130369278 GGGAAGAGGGAGCAGGAGGGAGG + Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1077141585 11:1027185-1027207 ATGCAGTGGCTGCAAGAGAGAGG + Exonic
1077186315 11:1236902-1236924 CTGCAGAGGCAGCGAGAGAGTGG - Intronic
1077249100 11:1552888-1552910 AGGAAGAGGAAGCAAGAGAGGGG - Intergenic
1077347694 11:2071687-2071709 ATGAGGTGGGAGCAGGAGGGAGG - Intergenic
1077730588 11:4725080-4725102 CTGAAGAAGGAGCAAGGGGGAGG - Intronic
1078398994 11:11007722-11007744 AACAAGAGGAAGCAGGAGGGAGG - Intergenic
1078406001 11:11070407-11070429 ATTTAGTGGCAGCAACAGGGAGG - Intergenic
1078572932 11:12475097-12475119 TTGAAGAGGCAGCTAGAGCAAGG - Intronic
1078640540 11:13091596-13091618 CTGAAGAGGCAGGAATAGGCAGG - Intergenic
1078799306 11:14627024-14627046 ATGAAGACACAGCAAGAAGGGGG - Intronic
1079630449 11:22667717-22667739 ATGAAGAGGGAGCAAAAGCGAGG + Intronic
1080165000 11:29225388-29225410 AAGAAGAGACAGAAAGAGGTGGG - Intergenic
1080354433 11:31425546-31425568 ATGAAGGCACAGCAAGAAGGAGG - Intronic
1080425596 11:32151245-32151267 ATCAAGTGGAAGCAAGAGGATGG + Intergenic
1080852090 11:36078749-36078771 ATGGAGAGGCAGGCAGAGAGGGG - Intronic
1080951207 11:37035308-37035330 AAGAAGAGAGAGAAAGAGGGAGG - Intergenic
1081194106 11:40140243-40140265 ATGAGGAGGCAGCAGGAGGCAGG - Intronic
1081639437 11:44742754-44742776 ATGCAAAGAGAGCAAGAGGGTGG + Intronic
1082008371 11:47433879-47433901 AGGAAGAGGAAGACAGAGGGAGG + Intergenic
1082801777 11:57420155-57420177 ATTATGAGGCAGCAAGCTGGAGG - Intronic
1083803963 11:65062803-65062825 AGGAAGAGGAAGCCTGAGGGAGG - Intergenic
1083893406 11:65608117-65608139 GTGAAGTGGCAGTAAGGGGGTGG - Intronic
1084800720 11:71542122-71542144 GTGAAGAGGCACCAAGGGTGAGG + Intronic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1084971140 11:72772722-72772744 AAGAAGAGGCAGAACCAGGGTGG - Intronic
1085299543 11:75450185-75450207 AGGAGGAGGCAGCAGGAGGCCGG + Intronic
1085593636 11:77789283-77789305 ATGAAGATGCAGCTCCAGGGAGG + Intronic
1085956692 11:81406523-81406545 ATGAAGAGACAAACAGAGGGAGG - Intergenic
1087534868 11:99430627-99430649 ATGGAGAGAGAGCAAGAGAGAGG + Intronic
1087864742 11:103210812-103210834 ATGAAGAGGGAGGAAAAGGTTGG + Intronic
1087974310 11:104525539-104525561 TGGAAAAGGCAGCAAGAGGGTGG + Intergenic
1088184533 11:107150682-107150704 GTGAGGATGCAGCAAGAAGGTGG - Intergenic
1088423831 11:109678442-109678464 AGAAAGTGGCAGCAAGATGGGGG + Intergenic
1088735612 11:112725475-112725497 ATGAACAGGGAGCAACATGGGGG + Intergenic
1088839446 11:113611598-113611620 GTGAGGACACAGCAAGAGGGAGG - Intergenic
1089383182 11:118050648-118050670 ATGATGAGGAAGCAAGGGTGGGG - Intergenic
1089487478 11:118858254-118858276 ATGAAGACACAGCGAGAAGGTGG - Intergenic
1090071588 11:123549020-123549042 CTGAAGAGGCAGGAAGATGCTGG + Intronic
1090111074 11:123910218-123910240 TTGAAGGTGGAGCAAGAGGGTGG + Intergenic
1090200163 11:124848359-124848381 ATAAACAGGCAGCAGGATGGGGG + Intergenic
1090381011 11:126327921-126327943 GTGAAGAGGAAGCAAGCTGGTGG + Intronic
1090543097 11:127730630-127730652 GTGAAGACACAGCGAGAGGGTGG - Intergenic
1090897561 11:130991921-130991943 ATGAAGAGAAACCAAGATGGAGG + Intergenic
1091134508 11:133176628-133176650 GTGAAGTGGGAGCAAGAGGAAGG - Intronic
1091242207 11:134060815-134060837 ATAAGGAGGAAGGAAGAGGGTGG + Intergenic
1091252340 11:134154420-134154442 AGGAAGAGGACGCAGGAGGGTGG - Intronic
1091857668 12:3752713-3752735 ATGAAGAGGCTGGATGAGGCTGG + Intronic
1092347505 12:7728096-7728118 GTGAAGACACAGCAAGAGTGTGG - Intergenic
1094341591 12:29417943-29417965 TTGAAAAGACAGCAAAAGGGAGG + Intronic
1094438218 12:30445288-30445310 GTGAAGAGGCAGCAAGAGGGTGG + Intergenic
1094639002 12:32255122-32255144 GTGAGGATGCAGCAAGAAGGTGG - Intronic
1095302626 12:40603315-40603337 ATGAAGAGGCAGTAAGGGGTAGG - Intergenic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1095765659 12:45891981-45892003 AGGAAGAGGAAGCAAGAGAATGG - Intronic
1096055528 12:48648177-48648199 CTGAAGAGGCACAATGAGGGTGG + Intergenic
1096254941 12:50057265-50057287 AGGAAGCAGCAGCAAGAGGCAGG + Intergenic
1096600853 12:52727764-52727786 ATGAAAAGGCAGGGAGAGGTGGG + Intergenic
1096814937 12:54196041-54196063 TTGAAGAGGGAGCTGGAGGGTGG - Intergenic
1096835810 12:54350527-54350549 ATGAAGAGCCAGGAACAGTGAGG - Exonic
1096838597 12:54367701-54367723 ATGAAGAGTTAGGAAGAAGGAGG + Intergenic
1097661791 12:62438108-62438130 ATGACAAGGCAACAAGATGGAGG + Intergenic
1097863145 12:64537919-64537941 GTGAGGATGCAGCAAGAAGGTGG - Intergenic
1098394428 12:70003118-70003140 AGGAGGAGGCAGCAGGAGGCAGG + Intergenic
1099891889 12:88599271-88599293 GTGATGAGGCAGCAAGAGGATGG - Intergenic
1100351794 12:93790977-93790999 ATGAAAAGGCAGGAAGTCGGGGG - Intronic
1100466554 12:94850657-94850679 AGAGAGAGGAAGCAAGAGGGAGG + Intergenic
1100593616 12:96052641-96052663 GTGAAGATACAGCAAGAAGGTGG + Intergenic
1101062295 12:100984752-100984774 AAAAAGAGGAAGCAAGAAGGAGG - Intronic
1101929974 12:109005942-109005964 TTCAAGTAGCAGCAAGAGGGTGG + Intronic
1102230261 12:111257289-111257311 AAGAAGTGGGAGGAAGAGGGAGG - Intronic
1102230374 12:111257659-111257681 AGGAAGAGGGGGGAAGAGGGAGG - Intronic
1102230377 12:111257669-111257691 AGGAGGAGGGAGGAAGAGGGGGG - Intronic
1102573202 12:113840272-113840294 AGGAAGAGGGGGCAAGAAGGTGG - Intronic
1103725423 12:122995327-122995349 GGGAAGAGGCTCCAAGAGGGAGG - Intronic
1104379951 12:128298649-128298671 ATACAGAGGTAGCAGGAGGGAGG - Intronic
1104574409 12:129953769-129953791 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1104926378 12:132316112-132316134 AAGAAGAGGCAGGCAGAGGCAGG + Intronic
1105386317 13:19932708-19932730 GTGAAGATCCAGCAAGAAGGTGG + Intergenic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1106130402 13:26934706-26934728 AGAGAGAGGCAGCAAGAGGAAGG - Intergenic
1106473681 13:30079247-30079269 ATGAAAAGGCTGAAAGGGGGAGG - Intergenic
1106538133 13:30666021-30666043 AGAAAGAGGCACCAAGAGGCTGG + Intergenic
1109202637 13:59448095-59448117 GTGAAGACACAGCAAGACGGTGG - Intergenic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1110413624 13:75229142-75229164 ATGAGGACACAGCAAGAAGGTGG + Intergenic
1112753668 13:102607056-102607078 ATGAGGACACAGCAAGAAGGTGG + Intronic
1113070037 13:106411428-106411450 ATGAAGAGGCTGCAAGAGGGTGG - Intergenic
1114823925 14:26054069-26054091 GTGAAGAGGCAGCAAGAATATGG + Intergenic
1115190323 14:30741195-30741217 ATGAGGACCCAGCAAGAAGGTGG + Intergenic
1115196776 14:30809304-30809326 ATGAAGACTCTGCAAGAGGCTGG + Intergenic
1115266544 14:31506579-31506601 ATAAAGAGGCAGTAAGAGGGAGG - Intronic
1115535926 14:34373369-34373391 AGGAGGAGGAAGCAAGAAGGTGG - Intronic
1116865815 14:50030698-50030720 ATGAGGACACAGCAAGACGGTGG + Intergenic
1116869927 14:50061088-50061110 GAGAAGAGGCTGGAAGAGGGTGG + Intergenic
1117704870 14:58454772-58454794 GTGAAGAGACAGCAAGAGGGAGG - Intronic
1118085874 14:62416427-62416449 TTAAAGAGGTAGTAAGAGGGAGG + Intergenic
1118704329 14:68466565-68466587 ATGACAAGGCAGCATGAGAGAGG - Intronic
1118767698 14:68921134-68921156 ATCAAGAGGGAGGAAGAGGAAGG + Intronic
1119536400 14:75406313-75406335 ATAAGGAAGCAGCCAGAGGGAGG - Intergenic
1119598125 14:75955448-75955470 AAGGGGAGGAAGCAAGAGGGCGG - Intronic
1119605063 14:76008591-76008613 AGGAAGAGGGAGCAGGAAGGAGG - Intronic
1119635846 14:76272779-76272801 AGAAAGAGGCAGAGAGAGGGGGG + Intergenic
1119687802 14:76646620-76646642 ATGAGGATACAGCAAGAGGGTGG - Intergenic
1120519343 14:85508427-85508449 AGGAAAAGGCAGCAAGGGTGAGG + Intergenic
1120625963 14:86827016-86827038 GGGAAGAGGCAGGAAGAGGAAGG + Intergenic
1120637567 14:86970748-86970770 ATGAGGACACAGCAAGAAGGTGG + Intergenic
1120688750 14:87568887-87568909 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1121002595 14:90463106-90463128 AGGAAGAGGAAGAAAGAGTGTGG + Intergenic
1121067201 14:90979289-90979311 AAGAAGTGGAAGGAAGAGGGAGG + Intronic
1121154413 14:91669374-91669396 CTGAAGGAGCAGCCAGAGGGTGG + Intronic
1121232436 14:92367559-92367581 GTGAAGGGGTATCAAGAGGGAGG + Intronic
1121577591 14:95001089-95001111 AGGAAGAGAAAGCAAGAGGCAGG + Intergenic
1122144687 14:99682752-99682774 AGGATGAGGCTGCAAGAAGGAGG - Intergenic
1122769559 14:104091954-104091976 ATGCAGAGGCTGCAGGAAGGTGG + Intronic
1122951331 14:105046876-105046898 TGGAAGAGACAGCATGAGGGGGG - Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123039665 14:105485335-105485357 AGGCAGAGGCACCAAGAAGGGGG - Intergenic
1123068406 14:105629407-105629429 CTGAACAGGCTGCAAGAGGCTGG - Intergenic
1123098003 14:105775432-105775454 CTGAACAGGCTGCAAGAGGCTGG - Intergenic
1123130487 14:105981745-105981767 AAGAAGAGGAAGCAGGAGGGAGG - Intergenic
1123409968 15:20050054-20050076 AAGAAGGGGAAGCAGGAGGGAGG + Intergenic
1123519300 15:21056761-21056783 AAGAAGGGGAAGCAGGAGGGAGG + Intergenic
1123580724 15:21712966-21712988 AAGAAGGGGAAGCAGGAGGGGGG - Intergenic
1123617373 15:22155589-22155611 AAGAAGGGGAAGCAGGAGGGGGG - Intergenic
1123901547 15:24882048-24882070 ATGAAGAGGCAGCTAGAAAGTGG - Intronic
1124338566 15:28875463-28875485 GTGTGGAGGCAGCAAGAGAGAGG - Intergenic
1125298883 15:38233223-38233245 ATGAAGGGGCAGAATGAAGGGGG + Intergenic
1125338536 15:38652060-38652082 TTGGAGAGGCAGGAAGAGAGGGG - Intergenic
1125531725 15:40417991-40418013 AGCAAAAGGTAGCAAGAGGGAGG - Intronic
1125818526 15:42607497-42607519 AAAAAGAGGCATCAGGAGGGTGG - Intronic
1125874807 15:43134197-43134219 AGGAAGAGGCAGCATGGGGAGGG - Intronic
1126176657 15:45742251-45742273 GTGAAGAGGCAGCGAGAGGGAGG + Intergenic
1126205017 15:46035609-46035631 ATGAGGACACAGCAAGAAGGTGG + Intergenic
1126896174 15:53259064-53259086 CTGAAGAGGCAGGAAGAAGAAGG + Intergenic
1127177854 15:56381013-56381035 AAGAAGAGGCAGAAAGAGAGAGG - Intronic
1127363762 15:58267879-58267901 GTGAAGAGGCAGCAATAGGGCGG - Intronic
1127962601 15:63900824-63900846 GTGAAGAGGCAGCAAGGAGGCGG + Intergenic
1128317872 15:66672445-66672467 GTGAAGAGGCAGCAAGAGAGTGG - Intronic
1128327674 15:66735624-66735646 ATGATGGGGCAGCAAGAATGTGG + Intronic
1128645419 15:69375233-69375255 GTGCAGAGGCAGCAAGAGAGTGG - Intronic
1128787002 15:70405022-70405044 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1128998181 15:72312177-72312199 AGGAAGAGGCTGCAGGAGGTGGG + Intronic
1129176374 15:73842456-73842478 GAAAAGAGGCAGCAAGAGGGCGG + Intergenic
1129289814 15:74556259-74556281 AAGAAGAGGGAGAAAGATGGAGG + Intronic
1129609764 15:77043880-77043902 GTGTGGAGGCAGCAGGAGGGAGG + Exonic
1130081565 15:80738373-80738395 ATGTACAGGCAGCAAGAGTAAGG + Intronic
1130251225 15:82301429-82301451 GTGGGGAGGGAGCAAGAGGGAGG - Intergenic
1130515912 15:84625655-84625677 ATGGAGAGGCAGGCATAGGGAGG - Intronic
1130721066 15:86386176-86386198 AGGAAGAGGGAGGAAGAGGGAGG - Intronic
1131121939 15:89828258-89828280 GAGAAGAGGCAGCTAGAGGCCGG + Intergenic
1131354739 15:91734914-91734936 AAGAAGAGGAAGAAAGAGGGAGG + Intergenic
1132335350 15:101044915-101044937 ATGAAGAGGCATCTAGCGAGAGG + Intronic
1132367175 15:101266092-101266114 GTGACCAGGCAGCAGGAGGGTGG + Intergenic
1202989594 15_KI270727v1_random:447211-447233 AAGAAGGGGAAGCAGGAGGGGGG - Intergenic
1132850247 16:2021780-2021802 TTGAAGAGGCAGCGGGAGGGAGG - Intergenic
1133110651 16:3546096-3546118 ATGAATAGGAAGCAGGAGGTGGG + Intronic
1133841663 16:9415768-9415790 AGGCAGAGGGAGCCAGAGGGAGG - Intergenic
1134081354 16:11327214-11327236 ATGGAGAGGCAAGAGGAGGGAGG + Intronic
1134904850 16:17971580-17971602 AAGAAGAGGAAGAAAGAGGCAGG + Intergenic
1135597899 16:23757167-23757189 GTGAAGAGGCAGCCATAAGGAGG - Intronic
1136141955 16:28293563-28293585 ATGGAGAGGGGGGAAGAGGGCGG + Intronic
1136230917 16:28884701-28884723 AGGAAGAGGCAACAAGGGGGAGG + Intronic
1136367417 16:29815142-29815164 ATGAGGAGGCAGGAAGAGGAAGG - Intronic
1136858740 16:33681838-33681860 AGGTAGAGGCAGGGAGAGGGAGG + Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137249898 16:46733681-46733703 ACCAAGAGGCAGCCAGAGGTGGG - Intronic
1137951406 16:52787126-52787148 ATGAAGAGGGAGAAATGGGGAGG - Intergenic
1138061597 16:53897024-53897046 ATGAGGAGGGAGCAGGATGGTGG - Intronic
1138153970 16:54685879-54685901 AGGAGGAGGGAGCAGGAGGGAGG - Intergenic
1138652832 16:58471608-58471630 ATTAAGAGGCAGGGAGGGGGTGG - Intronic
1138751765 16:59430905-59430927 ATGAACAGGCAGCAAGAGGATGG - Intergenic
1139352518 16:66346273-66346295 ATGATGAGGCAACAAGAGACAGG + Intergenic
1140651568 16:77094128-77094150 ATGAAGAGGAAGGAAGGGGGAGG - Intergenic
1140814179 16:78605262-78605284 AGGAAGAGGAAGCAGGAGGCTGG - Intronic
1140939052 16:79703901-79703923 ATGAAGAGGCAACAATACTGTGG + Intergenic
1140963623 16:79942304-79942326 ATGAAGAGGCAGCAAGGGGGTGG - Intergenic
1141016610 16:80456699-80456721 GTGAGGATGCAGCAAGAAGGGGG + Intergenic
1141146962 16:81537821-81537843 ATGAAGTGGCAGCAAGAGATTGG + Intronic
1141320638 16:83005334-83005356 ATGAACAGGGAGAAAGAGTGAGG - Intronic
1141398853 16:83728950-83728972 ATGAGGACACAGCAAGAAGGTGG - Intronic
1141623299 16:85248489-85248511 AGGAAGAGGCAGAGAAAGGGAGG - Intergenic
1141766665 16:86063690-86063712 AAGGAGAGGGAGGAAGAGGGAGG + Intergenic
1141992447 16:87618299-87618321 AAGAGGAGGCAGGAGGAGGGAGG + Intronic
1142153319 16:88522160-88522182 ATGAAGTGGCAGCAGCAAGGCGG + Intronic
1142551165 17:740789-740811 ATGAAATGGCAGAAAGAGTGTGG + Intronic
1143280865 17:5753157-5753179 AGGAAGAGGCAAGAAGAGAGAGG - Intergenic
1143310658 17:5985762-5985784 ATGAAGAGGCCACAAGCTGGTGG + Intronic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1144422993 17:15114879-15114901 GTGAGGAGAGAGCAAGAGGGTGG + Intergenic
1144453742 17:15402510-15402532 CAGAGGAGGCAGCAAGAGGCCGG + Intergenic
1144943916 17:18960193-18960215 ATGATGAGGCTGGATGAGGGAGG - Intronic
1145722699 17:27088539-27088561 ATGAGGAGGAGGAAAGAGGGTGG - Intergenic
1145751942 17:27361509-27361531 AAGGAGAGGCAGCAGGATGGAGG - Intergenic
1146672683 17:34752599-34752621 ATTCAGAGGGAGGAAGAGGGTGG - Intergenic
1146759108 17:35460643-35460665 AGGAAGAGGGAGCCAGAGGCCGG + Intergenic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1147542956 17:41376351-41376373 AAGAAGAGGCTCCAAGAAGGAGG - Intronic
1147704132 17:42414338-42414360 CTTAAGTGGTAGCAAGAGGGAGG - Intronic
1148213362 17:45821172-45821194 AGAAAGAGGCAGGAAGATGGGGG + Intronic
1148437281 17:47694271-47694293 AGGAGGAGGCGGCAGGAGGGCGG + Intronic
1148932217 17:51136400-51136422 ATAGAGAGACAGCTAGAGGGAGG + Intergenic
1149015822 17:51907329-51907351 AGGAAGAGGAAGGAAGAGGTTGG + Intronic
1149058053 17:52388586-52388608 GTGAAGTGGGAGCAAGGGGGAGG - Intergenic
1149636424 17:58174062-58174084 AGGAAGAGAGAGTAAGAGGGAGG - Intergenic
1149707460 17:58707869-58707891 ATGAGGACACAGCAAGAAGGTGG - Intronic
1151352039 17:73537514-73537536 ATGGAGAGGCAGGCAGAGGGTGG + Intronic
1151410575 17:73924816-73924838 ATGAAGACACAGCAAGAGGTCGG + Intergenic
1151732072 17:75917593-75917615 ATGTAGAGGCAGGAAGCGGCAGG + Intronic
1152243815 17:79175036-79175058 AGGAAGAGGAAGGAAGAGGCAGG - Intronic
1152418738 17:80180356-80180378 ATGGCGAGGCAGACAGAGGGTGG - Intronic
1153706076 18:7747331-7747353 ATGAAGAGGCAGAAAAGGAGAGG + Intronic
1153852229 18:9106188-9106210 AGGAAGAGCCAGAAAGGGGGAGG - Intronic
1153999247 18:10469805-10469827 ATGCAGAGTGAGCAAGAGGCTGG + Intronic
1154050673 18:10953822-10953844 AAGCAGGGGCAGCAAGAGAGAGG + Intronic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1154394546 18:13975012-13975034 ATGAGGAGACAGCAAGAGGATGG + Intergenic
1155083273 18:22431208-22431230 GTGAGGACGCAGCAAGAAGGTGG - Intergenic
1155249523 18:23941294-23941316 ATGGAGAGGCCACAAGGGGGAGG - Intronic
1156399755 18:36729590-36729612 TTGAAGACACAGCAAGAAGGTGG - Intronic
1156966493 18:43100363-43100385 AAGTAGAGAGAGCAAGAGGGAGG + Intronic
1157216635 18:45789102-45789124 AGGAAGACGGAGCAAGAGAGAGG - Intergenic
1157237917 18:45981471-45981493 GTGAAGAGGCAGCAAGAGAGTGG - Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157884093 18:51349679-51349701 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1157957131 18:52111030-52111052 GTGAAGATACAGCAAGAAGGAGG + Intergenic
1157959799 18:52140630-52140652 ATAAAGAGGCACAGAGAGGGTGG + Intergenic
1158454167 18:57592016-57592038 GTGCAGAGACAGCAAGAAGGTGG + Intergenic
1158625511 18:59068062-59068084 ATCAAGATGCAGCCACAGGGGGG - Intergenic
1158751293 18:60264267-60264289 GTGAGGAGGCAGCAAGAGGGCGG - Intergenic
1158951517 18:62499582-62499604 ATAAAGAGGAAGGAAGAAGGGGG - Intergenic
1158989143 18:62851148-62851170 ATGAGGAGGCAGCATGCGCGGGG - Intronic
1158991979 18:62878370-62878392 ATGAAGTAGCAGAGAGAGGGAGG - Intronic
1159120905 18:64169517-64169539 ATTATGAGACAGCAAGAGAGAGG - Intergenic
1160327632 18:77965660-77965682 GTGAGGATGCAGCAAGAAGGTGG - Intergenic
1160359096 18:78255556-78255578 AGGGAGAGGCAGCAAGACAGTGG + Intergenic
1160907933 19:1460530-1460552 CTGCAGAGGCAGCAACAGGGTGG - Intronic
1161024941 19:2032418-2032440 AAGAAGAGACTGGAAGAGGGCGG + Intronic
1161234504 19:3191147-3191169 GTGAAGTGGCAGCAAGTGGGGGG + Intronic
1161404045 19:4081932-4081954 AGGAAGAAGGAGCAAGAAGGAGG - Intergenic
1161665242 19:5571860-5571882 ATGAAGAGGCAACATCAAGGGGG + Intergenic
1162221264 19:9178726-9178748 ATAAAGAGGCCCCAAGAGGGTGG + Intergenic
1162393045 19:10401255-10401277 AGAAAGAAGCAGCAAGAGGTGGG + Intronic
1162834078 19:13304723-13304745 ATGAGGACACAGCAAGAAGGTGG + Intronic
1163053822 19:14704071-14704093 GTGAAGAGGCAGCAGGAGGGTGG - Intronic
1163105767 19:15122372-15122394 GAGAAGAGGAAGGAAGAGGGAGG + Intronic
1164971916 19:32539873-32539895 ATGAAGAGTCAGGCAGAGAGAGG + Intergenic
1165174408 19:33916914-33916936 GTGAAGAGGTAGCAAGAGAGTGG + Intergenic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1165795000 19:38514076-38514098 ATCATGAGGCAAAAAGAGGGCGG - Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166433081 19:42742525-42742547 AAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166627745 19:44374734-44374756 ATCAAGATGTAGCAAGAAGGAGG - Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167110561 19:47458200-47458222 ATGAACAGTCAGAAAGAGGTGGG - Intronic
1168102400 19:54148231-54148253 AGGCAGAGGCAGCAGGCGGGGGG - Exonic
925137156 2:1529919-1529941 ATGGGGAGGCTGCAAGGGGGGGG - Intronic
925594500 2:5542056-5542078 ATGATGATACAGCAAGAAGGTGG + Intergenic
926121184 2:10241946-10241968 ATGAATCGGCAACAAGAGTGAGG - Intergenic
926266833 2:11330853-11330875 AGGAAGAGGGAGGAGGAGGGAGG + Intronic
926557344 2:14374544-14374566 AGGAAGAGGGAGCAGGAGAGGGG + Intergenic
926657612 2:15425914-15425936 GAGAAGGGGCAGCCAGAGGGAGG - Intronic
926705028 2:15831038-15831060 ATGAAGAGACAGACAGAAGGTGG + Intergenic
926918512 2:17916342-17916364 AGGAAGAGGGAGAAAGAAGGAGG + Intronic
927281818 2:21315417-21315439 GTGAAGGGGTAGGAAGAGGGTGG + Intergenic
927456933 2:23260991-23261013 ATCAAGAGGTAGAAAGATGGTGG - Intergenic
928079900 2:28301629-28301651 TTGAGGGGGCAGAAAGAGGGTGG - Intronic
928426250 2:31180609-31180631 AGGATGAGGCAGCTAGAAGGTGG - Intronic
928921812 2:36534580-36534602 AGGGAGAGACAGGAAGAGGGAGG + Intronic
929213608 2:39386204-39386226 GTGAAGATGCACCAAGAAGGAGG + Intronic
929214774 2:39400516-39400538 ATGAAGGGGAAGAAAGAGAGGGG - Intronic
929223226 2:39486641-39486663 AAGAAGAGGAAGAAAGAGAGAGG + Intergenic
929412995 2:41718027-41718049 AAGTAGAGGCAGCAACTGGGTGG + Intergenic
929545375 2:42852096-42852118 GTGAAGAGGCAGTGAGAGGGTGG - Intergenic
931108532 2:59084515-59084537 GTGAAAACGCAGCAAGAAGGTGG - Intergenic
931121462 2:59224944-59224966 AGGAAGTGGTAGCAAGAGAGAGG + Intergenic
931216404 2:60248949-60248971 AGGAAGAGGCACCAAGAGAGAGG + Intergenic
931827298 2:66015030-66015052 ATGGGGAGGCAGGAAGAGAGAGG + Intergenic
932314761 2:70772560-70772582 ATGAGGACACAGCAAGAAGGTGG + Intergenic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
934126159 2:88892778-88892800 ATCAAATGGCAGCAAAAGGGTGG + Intergenic
934578145 2:95416104-95416126 ATGACCAGGCAGCCACAGGGAGG + Exonic
934601295 2:95660600-95660622 ATGACCAGGCAGCCACAGGGAGG - Intergenic
934770335 2:96903650-96903672 AGGAAGAGGAAGCCACAGGGAGG + Intronic
935047544 2:99495603-99495625 TTTAAGAGTCAGCAAGAGGTAGG - Intergenic
935566356 2:104612202-104612224 GGGAAAAGGCAGGAAGAGGGTGG - Intergenic
936339187 2:111616476-111616498 GTGAAAAGACAGCGAGAGGGCGG - Intergenic
936472415 2:112810953-112810975 ATGAGAAGACAGCAAGAGTGAGG - Intergenic
936534665 2:113302767-113302789 ATGACCAGGCAGCCACAGGGAGG - Intergenic
936763330 2:115813356-115813378 ATGAAGAGGCGCAAAGAGGGCGG - Intronic
936977235 2:118232373-118232395 GAGAAGAGGAAGGAAGAGGGAGG - Intergenic
937298514 2:120824260-120824282 ATAGAGAGGGAGGAAGAGGGAGG + Intronic
937706417 2:124926065-124926087 AAACAGAGGCAGCAAGAGAGTGG + Intergenic
938014251 2:127854421-127854443 CTGAAGAGGAAGCAACAGTGAGG + Intronic
938545767 2:132329845-132329867 ATCAAGATGTAGCAAGAAGGAGG + Intergenic
938594745 2:132776590-132776612 ATGAAGAAGCAGCAAGAAAATGG + Intronic
938719786 2:134056341-134056363 ATTAAGATTCAGCGAGAGGGAGG - Intergenic
939797000 2:146657326-146657348 GTGAAGATGCAGCAAGAAGAAGG + Intergenic
940412114 2:153377167-153377189 GGGGAGAGGCAGCAAGAGGATGG + Intergenic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
941567149 2:167123637-167123659 GTGAAGAGGCAGCAAGAGGGAGG - Intronic
941993076 2:171575932-171575954 ATGAAGAGGTACCTAGGGGGCGG - Intergenic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
942348582 2:175029210-175029232 AAATAGAGGCAGCAAGAGGGGGG + Intergenic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
942747504 2:179251783-179251805 ATGAAGACACAGCAAGAAGATGG + Intronic
942867823 2:180697860-180697882 ATGAAGAGGAAGCAAGCAAGAGG + Intergenic
944901394 2:204220196-204220218 ATGAAGACACGGCAAGAAGGTGG - Intergenic
945126452 2:206516542-206516564 ATGAAGACACAGCAAGAAGGTGG - Intronic
945946566 2:216001087-216001109 ATGCAGAGACAGCTAGAGAGAGG - Intronic
946148550 2:217748920-217748942 AGGAGGAGGCAGCAGGAAGGGGG - Intronic
946230624 2:218289109-218289131 GTGAATAGGCAGCACCAGGGTGG + Intronic
946322368 2:218961340-218961362 ATGGAAAGGCAGGGAGAGGGAGG - Exonic
946529762 2:220558735-220558757 GTGAACAGGCAACAAGCGGGTGG - Intergenic
946699336 2:222395900-222395922 ATGAAGAGGTAGCAAGAGGGTGG - Intergenic
946804254 2:223454275-223454297 GTGAAGACACAGCAAGAAGGCGG + Intergenic
946825888 2:223677451-223677473 ATGAAGATGCAACAAGAAGTTGG - Intergenic
947371434 2:229450707-229450729 GTGAGGAGGAAGCAAGAGGGTGG + Intronic
947377414 2:229510574-229510596 ATGAAGAGAGAGGGAGAGGGAGG + Intronic
947813194 2:233017748-233017770 ATGCAGAGGCAACTAGGGGGAGG + Intergenic
948091817 2:235301827-235301849 ATGAAGAGAAAGGAGGAGGGAGG - Intergenic
948091850 2:235301939-235301961 ATGAGGAGGGAGCAGGAGGGAGG - Intergenic
948091950 2:235302222-235302244 AGGAAGAGGGAGGAGGAGGGAGG - Intergenic
948293941 2:236847263-236847285 AGGCAGAGGGAGCCAGAGGGAGG + Intergenic
948507623 2:238440523-238440545 GGGAAGAGGCAGCAAAAGGGGGG - Intronic
948535950 2:238646946-238646968 AGGAAGAGACAGGTAGAGGGAGG + Intergenic
948798288 2:240418283-240418305 ATCAAGAGAAAACAAGAGGGAGG - Intergenic
1169803512 20:9535791-9535813 AGGAAGAGGTAGCAACTGGGAGG + Intergenic
1169938770 20:10914398-10914420 GTGAAGACACAGCAAGAGAGTGG + Intergenic
1170328275 20:15179996-15180018 ATGAAGAGTAAGCAAGAGGGTGG - Intronic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1171199226 20:23227646-23227668 GGGAAGAGGCAGCAAGACAGTGG + Intergenic
1171369723 20:24653814-24653836 GTGAAGTCGCAGCAAGAAGGCGG - Intronic
1171467008 20:25336833-25336855 ATGGAGAGGCAGGAGGAGTGGGG + Intronic
1171874628 20:30562599-30562621 ATCAAGATGTAGCAAGAAGGAGG + Intergenic
1172325919 20:34034380-34034402 AAGAAGTGGCAGCAAGAGCCTGG - Intronic
1172909843 20:38399867-38399889 GTGAAGAGGCTGCAAGAGAGTGG + Intergenic
1173054251 20:39595875-39595897 ATGAAGCGCTATCAAGAGGGAGG - Intergenic
1173262244 20:41446819-41446841 ACGCAGAGGAAGGAAGAGGGTGG + Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1174108010 20:48176749-48176771 ATGAAGAGGCACAAAGGGTGAGG - Intergenic
1174108123 20:48177489-48177511 ATGAAGAGGCACAAAGGGTGAGG + Intergenic
1175287738 20:57849045-57849067 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1175602490 20:60286399-60286421 ATGAAGGGCCAGCTAGAGGAAGG - Intergenic
1175701897 20:61145261-61145283 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1175817830 20:61892891-61892913 ATGGAAAGGTAGAAAGAGGGAGG + Intronic
1176057099 20:63154715-63154737 AGGAGGAGGGAGGAAGAGGGAGG - Intergenic
1176057116 20:63154767-63154789 AGGAGGAGGGAGGAAGAGGGAGG - Intergenic
1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG + Intergenic
1176376501 21:6089301-6089323 ATGAAGAGGCCGCATCAGGCGGG + Intergenic
1176511308 21:7750661-7750683 AAGAAGAGGCAGTGAGAGGATGG + Intronic
1177707031 21:24719868-24719890 GTAAAGATGCAGCAAGAAGGGGG - Intergenic
1177864798 21:26500084-26500106 GTGAAGACACAGCAAGATGGTGG - Intronic
1178470026 21:32884300-32884322 ATGAGGATGCAGCACTAGGGAGG - Intergenic
1178636906 21:34312036-34312058 TTGAAGAGGCAGCTAGATCGTGG + Intergenic
1178645422 21:34381190-34381212 AAGAAGAGGCAGTGAGAGGATGG + Intronic
1178756789 21:35357673-35357695 ATGAGGACACAGCAAGAAGGTGG + Intronic
1178900195 21:36592393-36592415 AGGAAGAGAGAGAAAGAGGGAGG - Intergenic
1179631550 21:42681792-42681814 ATGCAGAGGCAGCAAGATTAAGG - Intronic
1179642687 21:42757731-42757753 ATGAGGACCCAGCAAGAAGGCGG - Intronic
1179746974 21:43448943-43448965 ATGAAGAGGCCGCATCAGGCGGG - Intergenic
1179762371 21:43540861-43540883 ATGAAGAGGCAGCAAGAGGGTGG - Intronic
1179778857 21:43686706-43686728 ATGATGAGGCAGAAATTGGGAGG + Intronic
1179973155 21:44847474-44847496 CTGAGAAGGCAGCAGGAGGGTGG - Intergenic
1180121195 21:45749503-45749525 TTGAAGAGTCAGGGAGAGGGAGG + Intronic
1181102529 22:20550977-20550999 GTGAAAAGGCAGCAACAGGCTGG + Intronic
1181276104 22:21688373-21688395 TTGGAGAGGCTGCAGGAGGGAGG - Intronic
1181666486 22:24402011-24402033 GTAAAGAGGGAGCAAGAAGGAGG - Intronic
1182867372 22:33615530-33615552 GTGAAGACACAGCAAGAAGGTGG + Intronic
1182920927 22:34077964-34077986 ATGAGGATACAGCAAGAAGGTGG + Intergenic
1183236008 22:36618217-36618239 ATGAAGACGCAGCCATATGGTGG - Intronic
1183469501 22:37998032-37998054 GGGAAGAGGCAGGGAGAGGGTGG + Intronic
1184106739 22:42371749-42371771 AGGACCAGGCAGGAAGAGGGAGG - Intergenic
1184387135 22:44182635-44182657 CTGAAAAGGGAGGAAGAGGGAGG + Intronic
1184918281 22:47588304-47588326 GTGAGGAGGCAGGAAGAGAGTGG - Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
949128367 3:472612-472634 ATGAAGGGGCAGCAAGCAGGTGG - Intergenic
949873442 3:8608353-8608375 ATTCAGAGGCAGACAGAGGGAGG - Intergenic
950172099 3:10845894-10845916 TGGAAGAGGCAGCAAGGAGGAGG - Intronic
950524101 3:13513516-13513538 CTGAAGAGGCAGCAATATTGTGG - Intergenic
950810210 3:15643925-15643947 AAGAAGAGGAAGCAAAAGGAAGG + Intronic
951704086 3:25526282-25526304 TTGAAGAGGAAGCCAAAGGGTGG + Intronic
951930043 3:27955512-27955534 AGGAAGAGGAAGGAAGAGGAAGG - Intergenic
951930075 3:27955643-27955665 AGGAAGAGGAAGGAAGAGGAAGG - Intergenic
952563939 3:34632999-34633021 GTGAAGAGGCAATAAGAAGGTGG - Intergenic
952929739 3:38349806-38349828 GTGAAGACACAGCAAGAGAGTGG - Intronic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
954110778 3:48431612-48431634 ATGGAGAGGCAGTGATAGGGAGG - Intergenic
954266220 3:49472172-49472194 GTGGAGTGGCAGGAAGAGGGAGG + Intronic
954457423 3:50607455-50607477 AGGAAGAGCCAGCAAGAGCAAGG - Exonic
954643735 3:52117978-52118000 AAGAACAGACAGCAAGAGGGTGG + Intronic
954764276 3:52899703-52899725 AGGATGAGACAGCAAGAGAGGGG + Intergenic
955864542 3:63369191-63369213 GTGAAGAGGCAACAAGAGGGTGG + Intronic
955930863 3:64055518-64055540 ATGAATAGGGAGGAAGAGAGAGG - Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956772280 3:72536799-72536821 CTGAAGAGAAAGCAAGATGGGGG + Intergenic
957656952 3:83092602-83092624 GTGAAGAAGTAGCAAGAAGGTGG + Intergenic
957656956 3:83092631-83092653 GTGAAGAAGTAGCAAGAGGGTGG + Intergenic
958028894 3:88083048-88083070 AAGAAGAGGGAGGAAGAGGGAGG - Intronic
959381663 3:105648401-105648423 CTGATGAGGCAGCAAGAAAGCGG + Intergenic
959516166 3:107269487-107269509 ACGGAGAGGAAGCAAGAGTGGGG - Intergenic
959684592 3:109130615-109130637 GTGAGGAGGTAGCAAGAGAGTGG + Intergenic
959882483 3:111460665-111460687 GTAAATAAGCAGCAAGAGGGTGG + Intronic
960252962 3:115477101-115477123 AGGAAGAGGGAGAAAGAGAGAGG + Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960504820 3:118479685-118479707 AGGAAGAGAGAGGAAGAGGGAGG - Intergenic
960574038 3:119211986-119212008 ATGAAGAGGTAGCAGGAGGGTGG - Exonic
961495498 3:127288266-127288288 ATTAAGTGCCAGCAAAAGGGAGG + Intergenic
961725621 3:128927155-128927177 ATGAGTACGCAGCAAGATGGTGG + Intronic
962215432 3:133516859-133516881 GTGAAGAGGCAGCAAGAAGCTGG - Intergenic
962389928 3:134962792-134962814 ATGAAGAGGGGGCAGGAGGAGGG - Intronic
962415334 3:135176971-135176993 AGGAAGAGGAAGCAAGCGGAGGG - Intronic
962860164 3:139392154-139392176 ATGAAGAGGTAGGAATAGGGTGG - Intergenic
963073148 3:141321589-141321611 GTGAAGAGGCAGCAAAAGAGTGG + Intergenic
963813821 3:149807930-149807952 ATTAAGAGGCTGTAAGAGGCCGG - Intronic
964190580 3:153995904-153995926 ATGAAGACACAGTGAGAGGGAGG - Intergenic
964374433 3:156035594-156035616 AGGAGGAGGAAGCAGGAGGGGGG - Intergenic
965351324 3:167615007-167615029 ATGAAGAGGAAGGCAGAAGGAGG - Intronic
965560535 3:170058086-170058108 ATGAAGTAGAAGCAAGGGGGAGG + Intronic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967071430 3:185965757-185965779 AGAGAGAGGAAGCAAGAGGGAGG + Intergenic
967167765 3:186798455-186798477 ATGAATGGACAGGAAGAGGGAGG - Intronic
967207441 3:187137093-187137115 AGGCTGAGGCAGCAAGAGGATGG + Intronic
968251467 3:197219766-197219788 GTGAAGAGGCAGTAAGAAGGTGG + Intronic
968355865 3:198106219-198106241 AGGAAGAGGGAGAAAGATGGAGG - Intergenic
968566811 4:1317416-1317438 GACAAGAGCCAGCAAGAGGGTGG - Intronic
968809816 4:2794732-2794754 CTGAAGAGGCAGACAGAGGGAGG + Intronic
968942072 4:3644091-3644113 TGGAAGAGGCAGGAAGAGGAAGG + Intergenic
969451512 4:7276540-7276562 AGGAAGCGGCAGCAATAAGGGGG - Intronic
969479533 4:7440695-7440717 GAGGAGAGGCAGCATGAGGGTGG - Intronic
969849881 4:9947872-9947894 GTCAGGAGGCAGAAAGAGGGAGG - Intronic
970150592 4:13085547-13085569 ATGATGAGGCAGGAAGCAGGGGG - Intergenic
970702426 4:18757923-18757945 AGGAAGAGGTAGCAAGTGGGGGG + Intergenic
971012349 4:22452254-22452276 ATGAGGGGGTAGGAAGAGGGTGG + Intronic
971024513 4:22575451-22575473 GTGAAGACACAGCAAGACGGTGG + Intergenic
971166052 4:24184834-24184856 ATGATGAGGAAGAAAGAGAGAGG + Intergenic
971420439 4:26469253-26469275 GTGAACAGGCAGCAAGAGAGCGG - Intergenic
971424757 4:26504723-26504745 ATGAGGACACAGCAAGATGGCGG + Intergenic
971629322 4:28969351-28969373 ATGAAGACACAGCAAGAAGGAGG + Intergenic
972120861 4:35700597-35700619 CTGAGGAGGCAGCAAGAAGGTGG - Intergenic
972267990 4:37481569-37481591 GTGAAGAGTCGGCAAAAGGGTGG - Intronic
972389981 4:38605219-38605241 ATGAAGAGGATACAAGAGAGAGG - Intergenic
972881493 4:43428615-43428637 ATAAGGATGCAGCAAGAAGGTGG + Intergenic
972911374 4:43821702-43821724 AGGAAGAGGTATCAAGTGGGAGG + Intergenic
972944249 4:44234673-44234695 ACTAAAAGGAAGCAAGAGGGAGG - Intronic
973964528 4:56148033-56148055 GTGAAGACGTAGCAAGAAGGTGG + Intergenic
974091573 4:57316644-57316666 CTGAGGAGGCAGAAAGAGGGGGG + Intergenic
975684790 4:76908991-76909013 ATGAAGATGGAGCAAGAGATTGG - Intergenic
976201967 4:82587908-82587930 GAGGAAAGGCAGCAAGAGGGCGG - Intergenic
976920863 4:90441418-90441440 ATGAAGACACAGCAAAAAGGTGG - Intronic
978133341 4:105226634-105226656 AGGAAGAGGGAGGAAGAGGGAGG - Intronic
978212122 4:106149514-106149536 ATGAAGAGGGAGAAAAATGGAGG + Intronic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
979129646 4:117026383-117026405 ATGACCAGACAGCAAGAGTGAGG + Intergenic
979350034 4:119632745-119632767 GTGAAGAGGCAGCAAGAGAATGG + Intergenic
979625447 4:122839958-122839980 GTGAAGAGGCAGCTAGAGAGTGG - Intronic
979712993 4:123802844-123802866 AAGAAGAGGAAGGAAGACGGAGG - Intergenic
980128943 4:128800729-128800751 ATGAAGAGGCACAAAGTGGGAGG + Intergenic
981355715 4:143786986-143787008 AGCAAGAGGGAGCAAGTGGGTGG - Intergenic
981377041 4:144027874-144027896 AGCAAGAGGGAGCAAGTGGGTGG - Intergenic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
982875752 4:160647185-160647207 ATGAATGGGCTACAAGAGGGAGG + Intergenic
983193378 4:164778703-164778725 AGGAAGAGGCAGGAAGAGCTCGG + Intergenic
984769402 4:183424313-183424335 ATCAGGAGGCAGCAGGAGTGAGG + Intergenic
984930319 4:184841482-184841504 ATTTAGGGGCAGGAAGAGGGAGG + Intergenic
985487036 5:157832-157854 ATGGAGAGGCAGCAGTGGGGTGG + Intronic
985944632 5:3168443-3168465 ATGAAGATACAGCAAGAAGATGG + Intergenic
985997758 5:3606265-3606287 ATGAGGAGGCAGAGAAAGGGCGG + Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
986272539 5:6246376-6246398 AAGAAGAGGAAGCTAGAGGCAGG + Intergenic
986433378 5:7704040-7704062 ATGAAAGGGCAGCAACAGAGAGG + Intronic
986536060 5:8788708-8788730 AGGAAGAGAGAGCTAGAGGGAGG - Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987206791 5:15635587-15635609 ATGAAGAGGGAGCAATATAGGGG + Intronic
987359876 5:17097123-17097145 ATAAATAGGCAGGAAGAGTGGGG + Intronic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987689884 5:21252872-21252894 GTGAAGAGGCAGCAAGAAAGTGG + Intergenic
988731499 5:33977141-33977163 ATGAGGACACAGCAAGAAGGCGG + Intronic
988793790 5:34633695-34633717 ATAAAGAGGCAGCAAGACGGTGG - Intergenic
989264532 5:39457832-39457854 ATGAAGAGGCAGCAGGTTGATGG - Intronic
989300326 5:39884031-39884053 ATGAATAGGTAGCAAAATGGTGG - Intergenic
990442501 5:55860924-55860946 GTGAAGAGGCAGCAAAAGGAAGG - Intronic
990523307 5:56600698-56600720 AGGAAGAGGCAAGGAGAGGGAGG + Intronic
990730805 5:58806956-58806978 ATGCAGAGGTACCAACAGGGAGG + Intronic
991000840 5:61781282-61781304 ATGAAGAGGGAGCAAGAGGATGG + Intergenic
991065091 5:62416097-62416119 GAGAAAAGGCAGCAAGAAGGTGG - Intronic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992102666 5:73422307-73422329 ATGAAGACACAGCAAGCAGGTGG - Intergenic
992152237 5:73916526-73916548 GTGAAGACGCAGGAAGAAGGTGG - Intronic
992191392 5:74295419-74295441 GGGAGGAGACAGCAAGAGGGTGG + Intergenic
992261209 5:74972093-74972115 ATGAAGACACAGCAGCAGGGTGG + Intergenic
992889251 5:81188851-81188873 ATGGAGAGGCTGCAAGATTGGGG - Intronic
993465598 5:88242390-88242412 AGGAAGAGCCAGCAAATGGGAGG - Intronic
993539783 5:89134729-89134751 AGGGAGAGGGAGCAAGAGAGAGG + Intergenic
994254410 5:97576279-97576301 GTGAAGACACAGCAAGAAGGTGG + Intergenic
997291433 5:132738534-132738556 GTGCAGAAGAAGCAAGAGGGAGG - Intergenic
997370624 5:133357376-133357398 CTGAAGATGCAGCTAGAGAGAGG - Intronic
997896293 5:137720587-137720609 GTGAACAGGAAGGAAGAGGGAGG + Intronic
999118638 5:149188577-149188599 GCGAAGACGCAGCAAGATGGCGG - Intronic
999403794 5:151288482-151288504 AGGAAGAGGCAGACAGAGGGAGG + Intronic
999572267 5:152933081-152933103 AGGAAGAGGAAGAAAGGGGGAGG + Intergenic
999878353 5:155833732-155833754 ATGCAGGGGCAACATGAGGGGGG - Intergenic
1000953998 5:167520753-167520775 ATGAGGAAGCAGGAATAGGGAGG - Intronic
1001008624 5:168076913-168076935 ATGAACAGGCAGCCAGTAGGGGG - Intronic
1001136747 5:169108773-169108795 ATGGAGAAGCTCCAAGAGGGTGG + Intronic
1001413856 5:171529350-171529372 ATGAGGAGGAAGCCAGAGGAAGG - Intergenic
1001664561 5:173421731-173421753 GTGAAGAGGCAGCAAGAAAGTGG - Intergenic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002431977 5:179209007-179209029 TGGAAGAGGCAGCAGGAGAGAGG - Intronic
1002834512 6:854719-854741 ATAAAGAGCAAGCAAGAGGGAGG - Intergenic
1002966396 6:1970635-1970657 TTGAAGAGGCTACAAAAGGGAGG + Intronic
1004426831 6:15512408-15512430 ATGCGGGGGCAGCAAGCGGGAGG - Intronic
1004632093 6:17431865-17431887 ATGAAGAGCTTGCAATAGGGTGG + Intronic
1004648656 6:17587611-17587633 AGGAAGGGAGAGCAAGAGGGTGG - Intergenic
1005085970 6:22006924-22006946 GTCAAGAGGCAGTAAGAGGGTGG + Intergenic
1005449952 6:25962818-25962840 AGGAAGTGGCAGCAACAGAGGGG + Exonic
1005591833 6:27336876-27336898 TTAAAGAGGCAGAAAAAGGGAGG - Intergenic
1005677015 6:28165079-28165101 ATGAAGAGGGAGGAAAAGGGAGG - Intergenic
1005715752 6:28546176-28546198 ATTAAGAGGGGGCATGAGGGTGG - Intergenic
1006069931 6:31490908-31490930 AGGAAGAAGGAGCACGAGGGAGG - Intergenic
1006194232 6:32228185-32228207 ATGAAGAGTAACCAACAGGGAGG - Intergenic
1006372381 6:33653242-33653264 ATCAACAGGCAGCAAGTGGTGGG - Intronic
1006573420 6:35024663-35024685 GTGAAGTGGCAGCAACTGGGAGG + Intronic
1006573516 6:35025527-35025549 GTGAAGTGGCAGCAGCAGGGAGG - Intronic
1006679679 6:35788016-35788038 AGGAGGAGGCAGCAAGAAGGAGG - Exonic
1006846124 6:37062772-37062794 ATGAAAAGGCGGCTGGAGGGCGG - Intergenic
1006920895 6:37626363-37626385 AGGAAGGGGGAGCAAGAGGCCGG + Intergenic
1007274740 6:40665071-40665093 GTGAAGAGGCAGTGAGAGAGTGG - Intergenic
1007587502 6:43000599-43000621 CTGAGGAGGCAGCCAGAGAGGGG - Intronic
1010477737 6:76309684-76309706 ATTAAGAGGCAGGTAGAGTGGGG - Intergenic
1010647497 6:78408786-78408808 ATGAGGAGACAGCAAGCAGGTGG + Intergenic
1011128240 6:84029570-84029592 ATGAAGAGGCAGCATGGGGGTGG - Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011521916 6:88216951-88216973 GTGAAGACCCAGCAAGAGAGTGG - Intergenic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1012049277 6:94319681-94319703 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1012392600 6:98759988-98760010 AAGAAGAGGGAGAAAGATGGAGG - Intergenic
1013069836 6:106718797-106718819 AGGAAGAGGCAGCTACAGGCAGG - Intergenic
1013638968 6:112054483-112054505 ACGAAGATGGAGGAAGAGGGAGG + Intronic
1013724064 6:113070812-113070834 ATAAAGTGGAAGCAAGAGGTAGG + Intergenic
1013996990 6:116320682-116320704 GTGAAGAGGCAGCAATAGAGTGG - Intronic
1014040915 6:116823848-116823870 ATTAGGAGGAAGAAAGAGGGAGG + Intronic
1016688065 6:146903665-146903687 AGGAAGAGGCCTCAAGAGGAAGG - Intergenic
1016805494 6:148208063-148208085 ATGAGGAAGCAGGAAGAGGTGGG - Intergenic
1017350116 6:153430510-153430532 AGGGAGAGGAAGCAAGAGAGTGG - Intergenic
1017780259 6:157710301-157710323 ATGAGGACACAGCAAGAAGGTGG - Intronic
1018038045 6:159898542-159898564 AGGAAGAGGCAGGAGGAGGGAGG - Intergenic
1018038076 6:159898655-159898677 AGGAAGAGGAAGGAGGAGGGAGG - Intergenic
1018038084 6:159898681-159898703 ATGAAGGAGGAGGAAGAGGGAGG - Intergenic
1018729634 6:166638973-166638995 ATGAAGAGGGAGGAAGAAGAGGG + Intronic
1019328820 7:452816-452838 ATCAAGGGTCAGCAAGAGGGAGG + Intergenic
1019439982 7:1041122-1041144 ATGGAGAGACTGCAGGAGGGAGG + Intronic
1019705699 7:2496193-2496215 ATGCAGAGGCAGCAGGAGGGAGG + Intergenic
1019967875 7:4514815-4514837 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1020405986 7:7834595-7834617 GTGAAGACACAGCAAGAAGGTGG - Intronic
1021530071 7:21634365-21634387 AAAAGGAGGCAGCAAGAGAGTGG + Intronic
1021611983 7:22466465-22466487 GTGATGAGGCAGCAAGAGAGGGG + Intronic
1022566596 7:31409411-31409433 ATGAAGACAAAGCAAGAAGGTGG + Intergenic
1022998631 7:35784804-35784826 ATGGAGGGGCAGAAAGAGAGGGG - Intergenic
1023362003 7:39426567-39426589 AAGAAGAGGGAGGAAGAGGAGGG - Intronic
1023739478 7:43265934-43265956 ATGAAGAGGAAACTTGAGGGGGG + Intronic
1023879912 7:44312462-44312484 AAGGAGAGGGAGGAAGAGGGAGG + Intronic
1023988760 7:45115101-45115123 ATGATTATTCAGCAAGAGGGAGG + Intergenic
1024171405 7:46791300-46791322 ATGGAGGGGCAGCAAGGGGAAGG + Intergenic
1024391061 7:48812994-48813016 GTGAAGAGACAGTAAGAGGGTGG + Intergenic
1024976723 7:55120251-55120273 ATGAACAGGAACCACGAGGGTGG - Intronic
1025109636 7:56203244-56203266 CCTAAGAGGCAGCAAGAAGGAGG + Intergenic
1025945395 7:66100454-66100476 ATGAGGAGGAGGAAAGAGGGAGG + Intronic
1026330040 7:69344039-69344061 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1026380869 7:69798180-69798202 ATGAAGAGGAACCATGAGTGAGG - Intronic
1026979684 7:74519093-74519115 ATGCAGAGGCAGGAAGGGGAGGG + Intronic
1027409814 7:77904591-77904613 GTGAAGACACAGCAAGAAGGTGG - Intronic
1027706085 7:81535551-81535573 ATGCACAGGAGGCAAGAGGGCGG + Intergenic
1027882804 7:83863409-83863431 GTGAGGAGACAGCAAGAAGGAGG + Intergenic
1028210555 7:88069146-88069168 AGGGAGAGGGAGGAAGAGGGAGG - Intronic
1029007179 7:97222884-97222906 ATGAAGAGGCATCAATGGAGAGG - Intergenic
1029601572 7:101566617-101566639 GTGAAGACACAGCAAGAAGGCGG - Intergenic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1029978995 7:104860565-104860587 GTGAAGAGACTGCAAGATGGGGG - Intronic
1030713599 7:112783450-112783472 ATGAACAGTCAGGAAGCGGGAGG + Intronic
1031173536 7:118320689-118320711 AGGAACAGGGAGCAAGAGTGTGG - Intergenic
1031483619 7:122304953-122304975 AGGCAGAGGAAGCAAAAGGGGGG - Intronic
1032900030 7:136296647-136296669 ATGAGGACACAGCAAGAAGGCGG + Intergenic
1032961588 7:137041622-137041644 ATGAAGAAGCAGCAAGAAAATGG - Intergenic
1033259347 7:139829203-139829225 ATAAAGAGGAAGGAAGAGGAGGG - Intronic
1033952762 7:146805572-146805594 AGGAAGGAACAGCAAGAGGGAGG + Intronic
1033976102 7:147101977-147101999 ATGAACAGGAGACAAGAGGGTGG - Intronic
1034629769 7:152521953-152521975 ATGAAGAGAGAGCAAGCTGGGGG + Intergenic
1034750838 7:153567635-153567657 AGCAAGAGGATGCAAGAGGGAGG + Intergenic
1035116881 7:156532315-156532337 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1035249861 7:157589885-157589907 ATGAAGAGGGAGCTTGTGGGTGG + Intronic
1035277038 7:157753937-157753959 ATGAGGAGGGAGCAAGATGCTGG - Intronic
1035871921 8:3144780-3144802 AGAAAGAGGCAACAAGGGGGGGG + Intronic
1036007770 8:4686604-4686626 ATGAAGAGGTAGCCAGACGTCGG - Intronic
1036114421 8:5943355-5943377 ATGAAGATGCAGGAAGAAGGTGG - Intergenic
1036547699 8:9788072-9788094 GTGAAGAGGCCGACAGAGGGGGG + Intergenic
1036943637 8:13074080-13074102 ATGAAGACACAGCTATAGGGTGG - Intergenic
1037308610 8:17531201-17531223 ATAAAGAAGCAGCAAGAGCGGGG + Intronic
1037396571 8:18449907-18449929 ATGAAGACACAGGAAGAAGGTGG - Intergenic
1037745356 8:21639425-21639447 AGGAAGAGGGAGAAACAGGGAGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038529275 8:28304522-28304544 ATGAGGACACAGCAAGAAGGTGG - Intergenic
1038970635 8:32630070-32630092 ATGAAGAGTCAGAAAGACTGAGG - Intronic
1039642122 8:39235004-39235026 ATGAAGAGTCAGACAGAGAGGGG - Intronic
1040300399 8:46185010-46185032 ATGTTGAGGCAGGCAGAGGGGGG - Intergenic
1040578776 8:48677779-48677801 AGGCAGACGAAGCAAGAGGGTGG + Intergenic
1040602360 8:48897358-48897380 ATGAATGGGGAGCAAGAAGGGGG + Intergenic
1042190884 8:66186020-66186042 ATGAAGAGGCTGTAGGAGGCAGG - Intergenic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042709984 8:71706760-71706782 AAGAAAAGGCAGAAAGAGGCTGG + Intergenic
1042711989 8:71727828-71727850 ATGAGATGGAAGCAAGAGGGAGG - Intergenic
1043055935 8:75438533-75438555 ATGAAGAGAGAGAAAGAGGGAGG - Intronic
1043208342 8:77476345-77476367 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1044364423 8:91326410-91326432 GTGAGGAAGCAGCAAGAGGGAGG - Intronic
1044718292 8:95121478-95121500 TTGAAGAGGCACAAAGATGGTGG + Intergenic
1044852012 8:96437798-96437820 AGGAAGAGACAGCAGAAGGGAGG + Intergenic
1045319685 8:101072631-101072653 AACAAGAGGCAGGAAGAGGCAGG + Intergenic
1045949742 8:107838229-107838251 ATGCAGAGGCAGAAAGATAGGGG + Intergenic
1046101726 8:109622008-109622030 ATGAAGAGGAAGAAAGGAGGAGG - Intronic
1046625460 8:116572263-116572285 GAGAAGAGACAGCAAGAGAGCGG - Intergenic
1047324624 8:123824598-123824620 AGGAAGAGGCAGGATGGGGGTGG - Intergenic
1047508445 8:125497856-125497878 ATGGAGAGTCAGCAAGGTGGGGG + Intergenic
1047921508 8:129639408-129639430 ATGAAGAGGGAGAATCAGGGAGG + Intergenic
1048337687 8:133515070-133515092 ATGAAGAAGCTGGCAGAGGGTGG - Intronic
1048519421 8:135140006-135140028 ATGATGAGGGAGCTATAGGGAGG - Intergenic
1049241847 8:141541823-141541845 AGGAAGAGGCTGCAGGAGTGGGG - Intergenic
1049356738 8:142192850-142192872 ATGAAGAGGGAGTGGGAGGGAGG + Intergenic
1050744271 9:8858203-8858225 AAGAAGAGGCAGCAGGAAGGAGG - Intronic
1051026764 9:12622442-12622464 ATGCAGAGGCAGCAATCGGTTGG + Intergenic
1051109199 9:13616205-13616227 ATGAGGAGACAGCAAGGAGGAGG + Intergenic
1051596133 9:18825995-18826017 GTGATGAGACAGGAAGAGGGAGG - Intronic
1051898486 9:22013057-22013079 GTGAAGAGGCAGCAGTAGGATGG - Intronic
1051925593 9:22321076-22321098 ATGAGGAGGCAGAAATAAGGTGG + Intergenic
1052859225 9:33426673-33426695 ACAAAGGGGCAGCAGGAGGGTGG + Intergenic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1054764147 9:69029007-69029029 AGGAAGAGGCAGCAAGAGGGCGG - Intergenic
1055528689 9:77161125-77161147 AGGAAGAGGAAGAAAAAGGGGGG + Intergenic
1055732981 9:79298189-79298211 AGGAAGAGGTAGCCAGAGAGTGG + Intergenic
1056540227 9:87564609-87564631 AGGAGGAAGGAGCAAGAGGGAGG + Intronic
1056875969 9:90331062-90331084 AGGAAGTGGCAGGAAGATGGAGG + Intergenic
1057419107 9:94895075-94895097 ATCAAAAGGCAGCATGAGGCTGG + Intronic
1058197896 9:102001324-102001346 ATGGAGAGGGAGTAAGAGAGAGG - Intergenic
1058907491 9:109493781-109493803 ATGTAAAGGCAGCCAGGGGGAGG + Intronic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059496994 9:114718239-114718261 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1059670440 9:116485908-116485930 AGGAAGAGGCAGGGAGAGGAAGG + Intronic
1060034112 9:120240368-120240390 CTGAAGAGCCAGCAGGAGGGGGG + Intergenic
1060824604 9:126680752-126680774 GTGAAGGGGCAGAAAGAAGGGGG + Intronic
1061236021 9:129343017-129343039 AGGAAGGGGCAGCCAGAGGCTGG + Intergenic
1061916175 9:133755642-133755664 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1061996661 9:134189658-134189680 AGGAAGAGGGAGAGAGAGGGAGG + Intergenic
1062033594 9:134372897-134372919 GTGAAGGGGCAGCAGGAGAGGGG + Intronic
1062099964 9:134722957-134722979 TTGAGGAGGAAGCAAGAGTGGGG - Intronic
1062288443 9:135784133-135784155 GGGAAGCGGCAGCAGGAGGGTGG + Intronic
1062526609 9:136980436-136980458 ATGAAGGGGCTGCGGGAGGGAGG - Intronic
1185683825 X:1910685-1910707 AGGAAGAGGGAGGAAGAGAGAGG - Intergenic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1185999230 X:4989375-4989397 AGGAAGAGACAGAAGGAGGGAGG - Intergenic
1186470921 X:9821744-9821766 ATGCAAAGGCAGCAAAATGGTGG + Intronic
1187424932 X:19168758-19168780 ATGAAGAGGCAATGAGAGAGTGG + Intergenic
1187536880 X:20149053-20149075 GTGAAGAGGCAGCAAGAGGGCGG + Intergenic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1188079136 X:25815171-25815193 AGGAAGAGGGAGGAAGAGGGAGG - Intergenic
1188079139 X:25815181-25815203 AGGGAGAGGGAGGAAGAGGGAGG - Intergenic
1188266357 X:28080716-28080738 GTGAGGACACAGCAAGAGGGTGG + Intergenic
1188371711 X:29377767-29377789 ATGTAAAGGCAGCTAGAGAGAGG - Intronic
1188459346 X:30405440-30405462 ATGAAGATACAGGAAGAAGGTGG - Intergenic
1189139400 X:38585823-38585845 AAGAAGAGGGAGCAACAGAGAGG - Intronic
1189729099 X:44000317-44000339 AAGAAGAGTCAGCAAGGGAGGGG + Intergenic
1190101593 X:47526386-47526408 AGGAAGAGGAAGGAAGGGGGGGG - Intergenic
1190792210 X:53711024-53711046 GTGAAGAGGCAGCAAGAGAGAGG + Intergenic
1190821824 X:53980411-53980433 ATGAAGAGGCAGCAAGACGAAGG + Intronic
1191224678 X:58030917-58030939 CTGAAGTGGCAGTAAGAGAGGGG + Intergenic
1192300459 X:69896093-69896115 GTAAAGAGGCAGCAAGACAGTGG - Intronic
1193873270 X:86828525-86828547 ATAAAGAGGAAGCAAGATTGGGG - Intronic
1193929662 X:87536750-87536772 ATGAAGAAGGTGCAAGTGGGGGG + Intronic
1194599564 X:95903754-95903776 ATGAAGAGTCAGGCAGAGAGAGG - Intergenic
1194606543 X:95985813-95985835 ATCAAGTGGAAGCAAGATGGCGG - Intergenic
1194751948 X:97694716-97694738 GTGAAGTGGCAGCAAGAGAGTGG + Intergenic
1195366136 X:104127363-104127385 ATGAAGGGGAAGCACAAGGGAGG + Intronic
1195867452 X:109448392-109448414 TTGAAGAGGCACCAAAAGAGAGG + Intronic
1195934581 X:110112725-110112747 GTGAAGAGGCAGCATGAGGGTGG - Intronic
1196808790 X:119612127-119612149 ATTAAGAGGTAGCTAGAGGCTGG - Intergenic
1196973816 X:121137595-121137617 ATGCTGAGGCAACAAGAGGTGGG + Intergenic
1197634785 X:128902747-128902769 AAGAAAAGGCAGGAAGCGGGAGG + Intergenic
1197726057 X:129777324-129777346 GGGAAAAGGCAGCGAGAGGGAGG - Intergenic
1197823239 X:130562888-130562910 ATGAGGACACAGCAAGAAGGTGG - Intergenic
1197952198 X:131909572-131909594 AGGAAGAGGAAGAGAGAGGGAGG + Intergenic
1198516248 X:137410639-137410661 ATGAAGTAGTAGCAGGAGGGAGG - Intergenic
1198680111 X:139172444-139172466 ATGAAGAGAGGGCAAGAGGAAGG - Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199733433 X:150660811-150660833 TGGAAGAGGAAGCAAGAGAGAGG + Intronic
1199741237 X:150738595-150738617 GTGAAGAGGTAGCCAGAGGGTGG - Intronic
1199823868 X:151478122-151478144 ATGCAGAGCCTCCAAGAGGGGGG - Intergenic
1199881800 X:151979386-151979408 AGGAAGACACAGCTAGAGGGAGG + Intergenic
1200246095 X:154526584-154526606 ATGATGGGGCAGCAAGTTGGGGG + Intergenic
1201461697 Y:14232775-14232797 AGGAAGAGGAAGAAAGAGGGAGG - Intergenic
1201951537 Y:19570329-19570351 AGGAAGAGGCAGCAAAGGGGTGG - Intergenic
1202142441 Y:21742201-21742223 ATGAAGAGGAAGCTAGAGAAAGG - Intergenic
1202144417 Y:21763417-21763439 ATGAAGAGGAAGCTAGAGAAAGG + Intergenic