ID: 1176362502

View in Genome Browser
Species Human (GRCh38)
Location 21:6009749-6009771
Sequence AAGGCAACTCTCACCAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176362502_1176362505 20 Left 1176362502 21:6009749-6009771 CCATGATTGGTGAGAGTTGCCTT No data
Right 1176362505 21:6009792-6009814 ACTGCTGTAAAGAAATGCCTGGG No data
1176362502_1176362504 19 Left 1176362502 21:6009749-6009771 CCATGATTGGTGAGAGTTGCCTT No data
Right 1176362504 21:6009791-6009813 CACTGCTGTAAAGAAATGCCTGG No data
1176362502_1176362506 26 Left 1176362502 21:6009749-6009771 CCATGATTGGTGAGAGTTGCCTT No data
Right 1176362506 21:6009798-6009820 GTAAAGAAATGCCTGGGACTTGG 0: 3
1: 16
2: 478
3: 3145
4: 9960

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176362502 Original CRISPR AAGGCAACTCTCACCAATCA TGG (reversed) Intergenic
No off target data available for this crispr