ID: 1176363271

View in Genome Browser
Species Human (GRCh38)
Location 21:6016524-6016546
Sequence CCTCACCTGCAGAGTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176363271_1176363275 5 Left 1176363271 21:6016524-6016546 CCAGCCACACTCTGCAGGTGAGG No data
Right 1176363275 21:6016552-6016574 GGACTCTAGTGACAGAGTTGCGG No data
1176363271_1176363276 25 Left 1176363271 21:6016524-6016546 CCAGCCACACTCTGCAGGTGAGG No data
Right 1176363276 21:6016572-6016594 CGGTTACAGTCTGTGCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176363271 Original CRISPR CCTCACCTGCAGAGTGTGGC TGG (reversed) Intergenic
No off target data available for this crispr