ID: 1176364324

View in Genome Browser
Species Human (GRCh38)
Location 21:6023484-6023506
Sequence CTCCAGTGGAAGCCAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176364320_1176364324 -7 Left 1176364320 21:6023468-6023490 CCTGCCTTGGGCTCTGCTCCAGT No data
Right 1176364324 21:6023484-6023506 CTCCAGTGGAAGCCAGGTCCAGG No data
1176364319_1176364324 -6 Left 1176364319 21:6023467-6023489 CCCTGCCTTGGGCTCTGCTCCAG No data
Right 1176364324 21:6023484-6023506 CTCCAGTGGAAGCCAGGTCCAGG No data
1176364315_1176364324 23 Left 1176364315 21:6023438-6023460 CCACAACAGAGCTTTATGCGTAG No data
Right 1176364324 21:6023484-6023506 CTCCAGTGGAAGCCAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176364324 Original CRISPR CTCCAGTGGAAGCCAGGTCC AGG Intergenic
No off target data available for this crispr