ID: 1176369106

View in Genome Browser
Species Human (GRCh38)
Location 21:6051965-6051987
Sequence CCACGTCCCCACCTATGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176369106_1176369119 9 Left 1176369106 21:6051965-6051987 CCCATGCATAGGTGGGGACGTGG No data
Right 1176369119 21:6051997-6052019 GAGGCAGGGGGACAGGTCAGTGG No data
1176369106_1176369114 -3 Left 1176369106 21:6051965-6051987 CCCATGCATAGGTGGGGACGTGG No data
Right 1176369114 21:6051985-6052007 TGGAAGCCCCAGGAGGCAGGGGG No data
1176369106_1176369111 -6 Left 1176369106 21:6051965-6051987 CCCATGCATAGGTGGGGACGTGG No data
Right 1176369111 21:6051982-6052004 ACGTGGAAGCCCCAGGAGGCAGG No data
1176369106_1176369120 10 Left 1176369106 21:6051965-6051987 CCCATGCATAGGTGGGGACGTGG No data
Right 1176369120 21:6051998-6052020 AGGCAGGGGGACAGGTCAGTGGG No data
1176369106_1176369115 2 Left 1176369106 21:6051965-6051987 CCCATGCATAGGTGGGGACGTGG No data
Right 1176369115 21:6051990-6052012 GCCCCAGGAGGCAGGGGGACAGG No data
1176369106_1176369110 -10 Left 1176369106 21:6051965-6051987 CCCATGCATAGGTGGGGACGTGG No data
Right 1176369110 21:6051978-6052000 GGGGACGTGGAAGCCCCAGGAGG No data
1176369106_1176369121 13 Left 1176369106 21:6051965-6051987 CCCATGCATAGGTGGGGACGTGG No data
Right 1176369121 21:6052001-6052023 CAGGGGGACAGGTCAGTGGGTGG No data
1176369106_1176369112 -5 Left 1176369106 21:6051965-6051987 CCCATGCATAGGTGGGGACGTGG No data
Right 1176369112 21:6051983-6052005 CGTGGAAGCCCCAGGAGGCAGGG No data
1176369106_1176369113 -4 Left 1176369106 21:6051965-6051987 CCCATGCATAGGTGGGGACGTGG No data
Right 1176369113 21:6051984-6052006 GTGGAAGCCCCAGGAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176369106 Original CRISPR CCACGTCCCCACCTATGCAT GGG (reversed) Intergenic