ID: 1176369111

View in Genome Browser
Species Human (GRCh38)
Location 21:6051982-6052004
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176369101_1176369111 3 Left 1176369101 21:6051956-6051978 CCCGCAGATCCCATGCATAGGTG No data
Right 1176369111 21:6051982-6052004 ACGTGGAAGCCCCAGGAGGCAGG No data
1176369106_1176369111 -6 Left 1176369106 21:6051965-6051987 CCCATGCATAGGTGGGGACGTGG No data
Right 1176369111 21:6051982-6052004 ACGTGGAAGCCCCAGGAGGCAGG No data
1176369100_1176369111 4 Left 1176369100 21:6051955-6051977 CCCCGCAGATCCCATGCATAGGT No data
Right 1176369111 21:6051982-6052004 ACGTGGAAGCCCCAGGAGGCAGG No data
1176369108_1176369111 -7 Left 1176369108 21:6051966-6051988 CCATGCATAGGTGGGGACGTGGA No data
Right 1176369111 21:6051982-6052004 ACGTGGAAGCCCCAGGAGGCAGG No data
1176369097_1176369111 18 Left 1176369097 21:6051941-6051963 CCTGTGGGTGCAGCCCCCGCAGA No data
Right 1176369111 21:6051982-6052004 ACGTGGAAGCCCCAGGAGGCAGG No data
1176369102_1176369111 2 Left 1176369102 21:6051957-6051979 CCGCAGATCCCATGCATAGGTGG No data
Right 1176369111 21:6051982-6052004 ACGTGGAAGCCCCAGGAGGCAGG No data
1176369098_1176369111 5 Left 1176369098 21:6051954-6051976 CCCCCGCAGATCCCATGCATAGG No data
Right 1176369111 21:6051982-6052004 ACGTGGAAGCCCCAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176369111 Original CRISPR ACGTGGAAGCCCCAGGAGGC AGG Intergenic