ID: 1176369122

View in Genome Browser
Species Human (GRCh38)
Location 21:6052025-6052047
Sequence GGCAGGAGAGCAGGCTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176369122_1176369127 -8 Left 1176369122 21:6052025-6052047 CCTGCCCAGCCTGCTCTCCTGCC No data
Right 1176369127 21:6052040-6052062 CTCCTGCCCTCATGTCTGCTGGG No data
1176369122_1176369131 0 Left 1176369122 21:6052025-6052047 CCTGCCCAGCCTGCTCTCCTGCC No data
Right 1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG No data
1176369122_1176369126 -9 Left 1176369122 21:6052025-6052047 CCTGCCCAGCCTGCTCTCCTGCC No data
Right 1176369126 21:6052039-6052061 TCTCCTGCCCTCATGTCTGCTGG No data
1176369122_1176369132 22 Left 1176369122 21:6052025-6052047 CCTGCCCAGCCTGCTCTCCTGCC No data
Right 1176369132 21:6052070-6052092 GCAGTGTGCAGCATCAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176369122 Original CRISPR GGCAGGAGAGCAGGCTGGGC AGG (reversed) Intergenic