ID: 1176369123

View in Genome Browser
Species Human (GRCh38)
Location 21:6052029-6052051
Sequence TGAGGGCAGGAGAGCAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176369123_1176369133 30 Left 1176369123 21:6052029-6052051 CCCAGCCTGCTCTCCTGCCCTCA No data
Right 1176369133 21:6052082-6052104 ATCAGTGCTGGTCCCCCTAGTGG No data
1176369123_1176369132 18 Left 1176369123 21:6052029-6052051 CCCAGCCTGCTCTCCTGCCCTCA No data
Right 1176369132 21:6052070-6052092 GCAGTGTGCAGCATCAGTGCTGG No data
1176369123_1176369131 -4 Left 1176369123 21:6052029-6052051 CCCAGCCTGCTCTCCTGCCCTCA No data
Right 1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176369123 Original CRISPR TGAGGGCAGGAGAGCAGGCT GGG (reversed) Intergenic
No off target data available for this crispr