ID: 1176369124

View in Genome Browser
Species Human (GRCh38)
Location 21:6052030-6052052
Sequence ATGAGGGCAGGAGAGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176369124_1176369134 30 Left 1176369124 21:6052030-6052052 CCAGCCTGCTCTCCTGCCCTCAT No data
Right 1176369134 21:6052083-6052105 TCAGTGCTGGTCCCCCTAGTGGG No data
1176369124_1176369131 -5 Left 1176369124 21:6052030-6052052 CCAGCCTGCTCTCCTGCCCTCAT No data
Right 1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG No data
1176369124_1176369133 29 Left 1176369124 21:6052030-6052052 CCAGCCTGCTCTCCTGCCCTCAT No data
Right 1176369133 21:6052082-6052104 ATCAGTGCTGGTCCCCCTAGTGG No data
1176369124_1176369132 17 Left 1176369124 21:6052030-6052052 CCAGCCTGCTCTCCTGCCCTCAT No data
Right 1176369132 21:6052070-6052092 GCAGTGTGCAGCATCAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176369124 Original CRISPR ATGAGGGCAGGAGAGCAGGC TGG (reversed) Intergenic