ID: 1176369131

View in Genome Browser
Species Human (GRCh38)
Location 21:6052048-6052070
Sequence CTCATGTCTGCTGGGTGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176369122_1176369131 0 Left 1176369122 21:6052025-6052047 CCTGCCCAGCCTGCTCTCCTGCC No data
Right 1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG No data
1176369124_1176369131 -5 Left 1176369124 21:6052030-6052052 CCAGCCTGCTCTCCTGCCCTCAT No data
Right 1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG No data
1176369123_1176369131 -4 Left 1176369123 21:6052029-6052051 CCCAGCCTGCTCTCCTGCCCTCA No data
Right 1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG No data
1176369125_1176369131 -9 Left 1176369125 21:6052034-6052056 CCTGCTCTCCTGCCCTCATGTCT No data
Right 1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176369131 Original CRISPR CTCATGTCTGCTGGGTGACT TGG Intergenic
No off target data available for this crispr