ID: 1176370484

View in Genome Browser
Species Human (GRCh38)
Location 21:6059212-6059234
Sequence CTGGTTCCAGAGAACAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176370478_1176370484 2 Left 1176370478 21:6059187-6059209 CCAGGAAGTGGAAAGCCCTGGCT No data
Right 1176370484 21:6059212-6059234 CTGGTTCCAGAGAACAAACAGGG No data
1176370475_1176370484 14 Left 1176370475 21:6059175-6059197 CCTCTGCAGCAGCCAGGAAGTGG No data
Right 1176370484 21:6059212-6059234 CTGGTTCCAGAGAACAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176370484 Original CRISPR CTGGTTCCAGAGAACAAACA GGG Intergenic
No off target data available for this crispr