ID: 1176372628

View in Genome Browser
Species Human (GRCh38)
Location 21:6071599-6071621
Sequence CTATGGTTGCAGAGGCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176372628_1176372638 21 Left 1176372628 21:6071599-6071621 CCTTGTGGCCTCTGCAACCATAG No data
Right 1176372638 21:6071643-6071665 CATTTCAGGCACGGCCAAGTAGG No data
1176372628_1176372635 -2 Left 1176372628 21:6071599-6071621 CCTTGTGGCCTCTGCAACCATAG No data
Right 1176372635 21:6071620-6071642 AGGAATGCGGGTTTTGGAAGTGG No data
1176372628_1176372633 -8 Left 1176372628 21:6071599-6071621 CCTTGTGGCCTCTGCAACCATAG No data
Right 1176372633 21:6071614-6071636 AACCATAGGAATGCGGGTTTTGG No data
1176372628_1176372636 7 Left 1176372628 21:6071599-6071621 CCTTGTGGCCTCTGCAACCATAG No data
Right 1176372636 21:6071629-6071651 GGTTTTGGAAGTGGCATTTCAGG No data
1176372628_1176372637 12 Left 1176372628 21:6071599-6071621 CCTTGTGGCCTCTGCAACCATAG No data
Right 1176372637 21:6071634-6071656 TGGAAGTGGCATTTCAGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176372628 Original CRISPR CTATGGTTGCAGAGGCCACA AGG (reversed) Intergenic
No off target data available for this crispr