ID: 1176372868

View in Genome Browser
Species Human (GRCh38)
Location 21:6073139-6073161
Sequence GTGTGTTGGGGGGGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176372868_1176372881 14 Left 1176372868 21:6073139-6073161 CCCCCCACCCCCCCCCAACACAC No data
Right 1176372881 21:6073176-6073198 GTTTATCTGTTGAAGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176372868 Original CRISPR GTGTGTTGGGGGGGGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr