ID: 1176373465

View in Genome Browser
Species Human (GRCh38)
Location 21:6076083-6076105
Sequence TCTGGGGCAATCGCCGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176373465_1176373470 -2 Left 1176373465 21:6076083-6076105 CCAACAGCGGCGATTGCCCCAGA No data
Right 1176373470 21:6076104-6076126 GAAAGAACTTGGCGCTGCTAAGG No data
1176373465_1176373471 4 Left 1176373465 21:6076083-6076105 CCAACAGCGGCGATTGCCCCAGA No data
Right 1176373471 21:6076110-6076132 ACTTGGCGCTGCTAAGGCAATGG No data
1176373465_1176373472 7 Left 1176373465 21:6076083-6076105 CCAACAGCGGCGATTGCCCCAGA No data
Right 1176373472 21:6076113-6076135 TGGCGCTGCTAAGGCAATGGCGG No data
1176373465_1176373473 18 Left 1176373465 21:6076083-6076105 CCAACAGCGGCGATTGCCCCAGA No data
Right 1176373473 21:6076124-6076146 AGGCAATGGCGGCCCGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176373465 Original CRISPR TCTGGGGCAATCGCCGCTGT TGG (reversed) Intergenic
No off target data available for this crispr