ID: 1176373738

View in Genome Browser
Species Human (GRCh38)
Location 21:6077244-6077266
Sequence GCTTCCTCCAGGAGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176373725_1176373738 23 Left 1176373725 21:6077198-6077220 CCATTGCTCCAGCAGGGATGTGG No data
Right 1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG No data
1176373724_1176373738 24 Left 1176373724 21:6077197-6077219 CCCATTGCTCCAGCAGGGATGTG No data
Right 1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG No data
1176373723_1176373738 25 Left 1176373723 21:6077196-6077218 CCCCATTGCTCCAGCAGGGATGT No data
Right 1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG No data
1176373728_1176373738 15 Left 1176373728 21:6077206-6077228 CCAGCAGGGATGTGGAACGGTGC No data
Right 1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG No data
1176373730_1176373738 -7 Left 1176373730 21:6077228-6077250 CCAGCGCTGCCCGGCCGCTTCCT No data
Right 1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176373738 Original CRISPR GCTTCCTCCAGGAGGCTGGG TGG Intergenic
No off target data available for this crispr