ID: 1176374657

View in Genome Browser
Species Human (GRCh38)
Location 21:6081024-6081046
Sequence ATGGAGAAACTGACAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176374651_1176374657 13 Left 1176374651 21:6080988-6081010 CCCGATGGGAACTCTCATTTATC No data
Right 1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG No data
1176374652_1176374657 12 Left 1176374652 21:6080989-6081011 CCGATGGGAACTCTCATTTATCA No data
Right 1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176374657 Original CRISPR ATGGAGAAACTGACAGAGAA GGG Intergenic
No off target data available for this crispr