ID: 1176375364

View in Genome Browser
Species Human (GRCh38)
Location 21:6084460-6084482
Sequence GGCTTCTCCAGCCAGCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176375364_1176375372 1 Left 1176375364 21:6084460-6084482 CCCCCTGGCTGGCTGGAGAAGCC No data
Right 1176375372 21:6084484-6084506 CATGTGCCGAGCCTGGTCCGAGG No data
1176375364_1176375368 -6 Left 1176375364 21:6084460-6084482 CCCCCTGGCTGGCTGGAGAAGCC No data
Right 1176375368 21:6084477-6084499 GAAGCCCCATGTGCCGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176375364 Original CRISPR GGCTTCTCCAGCCAGCCAGG GGG (reversed) Intergenic
No off target data available for this crispr