ID: 1176375869

View in Genome Browser
Species Human (GRCh38)
Location 21:6086655-6086677
Sequence CCTTGGGGCTCCTGCTCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176375852_1176375869 24 Left 1176375852 21:6086608-6086630 CCTCCCAGCTACACGTGGCCCAC No data
Right 1176375869 21:6086655-6086677 CCTTGGGGCTCCTGCTCTCGGGG No data
1176375855_1176375869 6 Left 1176375855 21:6086626-6086648 CCCACTCGCCTCCACAGCCGCCA No data
Right 1176375869 21:6086655-6086677 CCTTGGGGCTCCTGCTCTCGGGG No data
1176375857_1176375869 -2 Left 1176375857 21:6086634-6086656 CCTCCACAGCCGCCAAGCCTCCC No data
Right 1176375869 21:6086655-6086677 CCTTGGGGCTCCTGCTCTCGGGG No data
1176375858_1176375869 -5 Left 1176375858 21:6086637-6086659 CCACAGCCGCCAAGCCTCCCTTG No data
Right 1176375869 21:6086655-6086677 CCTTGGGGCTCCTGCTCTCGGGG No data
1176375851_1176375869 28 Left 1176375851 21:6086604-6086626 CCGGCCTCCCAGCTACACGTGGC No data
Right 1176375869 21:6086655-6086677 CCTTGGGGCTCCTGCTCTCGGGG No data
1176375853_1176375869 21 Left 1176375853 21:6086611-6086633 CCCAGCTACACGTGGCCCACTCG No data
Right 1176375869 21:6086655-6086677 CCTTGGGGCTCCTGCTCTCGGGG No data
1176375854_1176375869 20 Left 1176375854 21:6086612-6086634 CCAGCTACACGTGGCCCACTCGC No data
Right 1176375869 21:6086655-6086677 CCTTGGGGCTCCTGCTCTCGGGG No data
1176375856_1176375869 5 Left 1176375856 21:6086627-6086649 CCACTCGCCTCCACAGCCGCCAA No data
Right 1176375869 21:6086655-6086677 CCTTGGGGCTCCTGCTCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176375869 Original CRISPR CCTTGGGGCTCCTGCTCTCG GGG Intergenic
No off target data available for this crispr