ID: 1176379173

View in Genome Browser
Species Human (GRCh38)
Location 21:6103222-6103244
Sequence GAGTTTCATTTTTAACTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176379171_1176379173 12 Left 1176379171 21:6103187-6103209 CCAGTACAGTACTGAATTCAATA No data
Right 1176379173 21:6103222-6103244 GAGTTTCATTTTTAACTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176379173 Original CRISPR GAGTTTCATTTTTAACTGCA TGG Intergenic
No off target data available for this crispr