ID: 1176380025

View in Genome Browser
Species Human (GRCh38)
Location 21:6107767-6107789
Sequence CCATTTAAGCAGCCCGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176380018_1176380025 20 Left 1176380018 21:6107724-6107746 CCGTGAACAGGCACGTTTCTGCT No data
Right 1176380025 21:6107767-6107789 CCATTTAAGCAGCCCGTGGAAGG No data
1176380017_1176380025 21 Left 1176380017 21:6107723-6107745 CCCGTGAACAGGCACGTTTCTGC No data
Right 1176380025 21:6107767-6107789 CCATTTAAGCAGCCCGTGGAAGG No data
1176380021_1176380025 -9 Left 1176380021 21:6107753-6107775 CCGGCCTTCGTGGTCCATTTAAG No data
Right 1176380025 21:6107767-6107789 CCATTTAAGCAGCCCGTGGAAGG No data
1176380016_1176380025 29 Left 1176380016 21:6107715-6107737 CCGACTGGCCCGTGAACAGGCAC No data
Right 1176380025 21:6107767-6107789 CCATTTAAGCAGCCCGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176380025 Original CRISPR CCATTTAAGCAGCCCGTGGA AGG Intergenic
No off target data available for this crispr