ID: 1176380501

View in Genome Browser
Species Human (GRCh38)
Location 21:6110359-6110381
Sequence GGGGCTGCCCCCGCAGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176380501_1176380507 6 Left 1176380501 21:6110359-6110381 CCACATGCTGCGGGGGCAGCCCC No data
Right 1176380507 21:6110388-6110410 CGCAGACGCCAGCGCCGCTGAGG No data
1176380501_1176380510 12 Left 1176380501 21:6110359-6110381 CCACATGCTGCGGGGGCAGCCCC No data
Right 1176380510 21:6110394-6110416 CGCCAGCGCCGCTGAGGGCCGGG No data
1176380501_1176380511 13 Left 1176380501 21:6110359-6110381 CCACATGCTGCGGGGGCAGCCCC No data
Right 1176380511 21:6110395-6110417 GCCAGCGCCGCTGAGGGCCGGGG No data
1176380501_1176380513 17 Left 1176380501 21:6110359-6110381 CCACATGCTGCGGGGGCAGCCCC No data
Right 1176380513 21:6110399-6110421 GCGCCGCTGAGGGCCGGGGCCGG No data
1176380501_1176380508 7 Left 1176380501 21:6110359-6110381 CCACATGCTGCGGGGGCAGCCCC No data
Right 1176380508 21:6110389-6110411 GCAGACGCCAGCGCCGCTGAGGG No data
1176380501_1176380509 11 Left 1176380501 21:6110359-6110381 CCACATGCTGCGGGGGCAGCCCC No data
Right 1176380509 21:6110393-6110415 ACGCCAGCGCCGCTGAGGGCCGG No data
1176380501_1176380514 18 Left 1176380501 21:6110359-6110381 CCACATGCTGCGGGGGCAGCCCC No data
Right 1176380514 21:6110400-6110422 CGCCGCTGAGGGCCGGGGCCGGG No data
1176380501_1176380516 23 Left 1176380501 21:6110359-6110381 CCACATGCTGCGGGGGCAGCCCC No data
Right 1176380516 21:6110405-6110427 CTGAGGGCCGGGGCCGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176380501 Original CRISPR GGGGCTGCCCCCGCAGCATG TGG (reversed) Intergenic