ID: 1176380507

View in Genome Browser
Species Human (GRCh38)
Location 21:6110388-6110410
Sequence CGCAGACGCCAGCGCCGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176380496_1176380507 13 Left 1176380496 21:6110352-6110374 CCCAGCCCCACATGCTGCGGGGG No data
Right 1176380507 21:6110388-6110410 CGCAGACGCCAGCGCCGCTGAGG No data
1176380500_1176380507 7 Left 1176380500 21:6110358-6110380 CCCACATGCTGCGGGGGCAGCCC No data
Right 1176380507 21:6110388-6110410 CGCAGACGCCAGCGCCGCTGAGG No data
1176380499_1176380507 8 Left 1176380499 21:6110357-6110379 CCCCACATGCTGCGGGGGCAGCC No data
Right 1176380507 21:6110388-6110410 CGCAGACGCCAGCGCCGCTGAGG No data
1176380492_1176380507 30 Left 1176380492 21:6110335-6110357 CCGCGCGGGAAGAGGGTCCCAGC No data
Right 1176380507 21:6110388-6110410 CGCAGACGCCAGCGCCGCTGAGG No data
1176380498_1176380507 12 Left 1176380498 21:6110353-6110375 CCAGCCCCACATGCTGCGGGGGC No data
Right 1176380507 21:6110388-6110410 CGCAGACGCCAGCGCCGCTGAGG No data
1176380501_1176380507 6 Left 1176380501 21:6110359-6110381 CCACATGCTGCGGGGGCAGCCCC No data
Right 1176380507 21:6110388-6110410 CGCAGACGCCAGCGCCGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176380507 Original CRISPR CGCAGACGCCAGCGCCGCTG AGG Intergenic