ID: 1176380508

View in Genome Browser
Species Human (GRCh38)
Location 21:6110389-6110411
Sequence GCAGACGCCAGCGCCGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176380498_1176380508 13 Left 1176380498 21:6110353-6110375 CCAGCCCCACATGCTGCGGGGGC No data
Right 1176380508 21:6110389-6110411 GCAGACGCCAGCGCCGCTGAGGG No data
1176380500_1176380508 8 Left 1176380500 21:6110358-6110380 CCCACATGCTGCGGGGGCAGCCC No data
Right 1176380508 21:6110389-6110411 GCAGACGCCAGCGCCGCTGAGGG No data
1176380501_1176380508 7 Left 1176380501 21:6110359-6110381 CCACATGCTGCGGGGGCAGCCCC No data
Right 1176380508 21:6110389-6110411 GCAGACGCCAGCGCCGCTGAGGG No data
1176380499_1176380508 9 Left 1176380499 21:6110357-6110379 CCCCACATGCTGCGGGGGCAGCC No data
Right 1176380508 21:6110389-6110411 GCAGACGCCAGCGCCGCTGAGGG No data
1176380496_1176380508 14 Left 1176380496 21:6110352-6110374 CCCAGCCCCACATGCTGCGGGGG No data
Right 1176380508 21:6110389-6110411 GCAGACGCCAGCGCCGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176380508 Original CRISPR GCAGACGCCAGCGCCGCTGA GGG Intergenic