ID: 1176380513

View in Genome Browser
Species Human (GRCh38)
Location 21:6110399-6110421
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176380498_1176380513 23 Left 1176380498 21:6110353-6110375 CCAGCCCCACATGCTGCGGGGGC No data
Right 1176380513 21:6110399-6110421 GCGCCGCTGAGGGCCGGGGCCGG No data
1176380496_1176380513 24 Left 1176380496 21:6110352-6110374 CCCAGCCCCACATGCTGCGGGGG No data
Right 1176380513 21:6110399-6110421 GCGCCGCTGAGGGCCGGGGCCGG No data
1176380501_1176380513 17 Left 1176380501 21:6110359-6110381 CCACATGCTGCGGGGGCAGCCCC No data
Right 1176380513 21:6110399-6110421 GCGCCGCTGAGGGCCGGGGCCGG No data
1176380499_1176380513 19 Left 1176380499 21:6110357-6110379 CCCCACATGCTGCGGGGGCAGCC No data
Right 1176380513 21:6110399-6110421 GCGCCGCTGAGGGCCGGGGCCGG No data
1176380500_1176380513 18 Left 1176380500 21:6110358-6110380 CCCACATGCTGCGGGGGCAGCCC No data
Right 1176380513 21:6110399-6110421 GCGCCGCTGAGGGCCGGGGCCGG No data
1176380505_1176380513 -3 Left 1176380505 21:6110379-6110401 CCCGGGACGCGCAGACGCCAGCG No data
Right 1176380513 21:6110399-6110421 GCGCCGCTGAGGGCCGGGGCCGG No data
1176380506_1176380513 -4 Left 1176380506 21:6110380-6110402 CCGGGACGCGCAGACGCCAGCGC No data
Right 1176380513 21:6110399-6110421 GCGCCGCTGAGGGCCGGGGCCGG No data
1176380504_1176380513 -2 Left 1176380504 21:6110378-6110400 CCCCGGGACGCGCAGACGCCAGC No data
Right 1176380513 21:6110399-6110421 GCGCCGCTGAGGGCCGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176380513 Original CRISPR GCGCCGCTGAGGGCCGGGGC CGG Intergenic