ID: 1176381625

View in Genome Browser
Species Human (GRCh38)
Location 21:6116745-6116767
Sequence GCTGGCAGGCACGGAGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 2, 1: 0, 2: 10, 3: 44, 4: 480}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176381620_1176381625 1 Left 1176381620 21:6116721-6116743 CCGGGGTGGGAGCAGGGACATCA 0: 4
1: 0
2: 4
3: 35
4: 310
Right 1176381625 21:6116745-6116767 GCTGGCAGGCACGGAGGCCCCGG 0: 2
1: 0
2: 10
3: 44
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176381625 Original CRISPR GCTGGCAGGCACGGAGGCCC CGG Intronic
900199659 1:1398833-1398855 ACTGGCGGGCGGGGAGGCCCCGG + Intronic
900313259 1:2044856-2044878 GGCGGGAGGCCCGGAGGCCCCGG + Intergenic
900399323 1:2466575-2466597 GCAGGCAGGCACGCAGGCCCGGG - Intronic
900478387 1:2886850-2886872 GCTGGGAGGCTGGGAGGCCGGGG - Intergenic
900478421 1:2886946-2886968 GCTGGGAGGCTGGGAGGCCAGGG - Intergenic
900697398 1:4020898-4020920 AGTGGCAGGCAGGGAGGCCATGG - Intergenic
900973814 1:6005666-6005688 CCGGGGAGGCACGGAAGCCCAGG + Intronic
901398641 1:9000918-9000940 GCTGGAAGACTCGGAGGCCCAGG - Intergenic
901712951 1:11130101-11130123 GCTGGCAGGCCCAGAGATCCGGG - Intronic
901856467 1:12047583-12047605 GCTGACAAGCAGGGAAGCCCTGG - Intergenic
902192543 1:14773744-14773766 GATGGCAGCCCCGGAAGCCCAGG - Intronic
902437883 1:16409777-16409799 GCTGGCAGGGACCGAGGCAGGGG + Exonic
902515210 1:16986325-16986347 GCAGGCAGGCGGGGAGGCACTGG + Exonic
902565544 1:17308816-17308838 GCTGGCTAGCAAGGAGGCCTTGG + Intronic
903035486 1:20490155-20490177 GAAGGCAGGCACAGAGGCCTGGG - Intergenic
903509932 1:23867662-23867684 GATGGCAGGCTGGGAAGCCCTGG - Intronic
903650943 1:24921709-24921731 GCTGGCAGGGTCAGAGGCTCAGG - Intronic
904463273 1:30693035-30693057 GCTGGGAGGAGCGGAGGCCGGGG - Intergenic
904500032 1:30908305-30908327 GGTGGCAGGGACCGCGGCCCCGG + Intronic
904598042 1:31658936-31658958 CCTGGCTGGCCTGGAGGCCCTGG + Exonic
904613449 1:31737545-31737567 GCAGGCAGGGACAGAGGCGCTGG + Intronic
904837598 1:33349475-33349497 CCTGGCAGCCGCGTAGGCCCGGG + Intronic
905688577 1:39926468-39926490 ACTGGCAGGCAGGGAGACCAAGG - Intergenic
905945474 1:41898024-41898046 GATGGCAGGCTCTGAGGCTCTGG - Intronic
906117949 1:43367976-43367998 GCAGGCAGGCAGGCTGGCCCCGG - Intronic
907051099 1:51330403-51330425 GCTGGGAGGCCCGGGGGCGCGGG - Intronic
909643264 1:77889213-77889235 GCTGGCAGAGACGGAGACCGCGG - Intronic
909924509 1:81423346-81423368 GCTGGCAGGCAGGCATGCCCAGG + Intronic
910439867 1:87240996-87241018 GCTGGCAGGGATGGAGGCCTGGG + Intergenic
912497921 1:110103194-110103216 GCAGGCAGGGAGGGAGGCCAGGG + Intergenic
915348103 1:155208265-155208287 GCTGGCAGGAAAGGATGCCAAGG + Intronic
915585295 1:156840942-156840964 GGTGGTAGGCAGGGAGCCCCGGG + Exonic
918048457 1:180954978-180955000 GCTGGAAGTCACAGAGGGCCAGG - Intergenic
920035820 1:203064791-203064813 GCTGGGGGGCTGGGAGGCCCTGG - Intronic
920665897 1:207962973-207962995 GCTGGCGGGCCTGGAGGCCTTGG + Intergenic
921312948 1:213862394-213862416 GCTGGCATGCACTCTGGCCCAGG - Intergenic
921934732 1:220786389-220786411 GCTCGCCGGCGCGGAGGGCCTGG + Intergenic
922696895 1:227735387-227735409 GCGTGCAGGCCCGGAGCCCCAGG - Exonic
922702914 1:227772119-227772141 GCTGGGTGTCATGGAGGCCCTGG + Intronic
922720341 1:227896995-227897017 GGGGGCAGCCTCGGAGGCCCAGG + Intergenic
923865790 1:237938162-237938184 AAGAGCAGGCACGGAGGCCCTGG + Intergenic
924496851 1:244598778-244598800 GTTGGAATGCCCGGAGGCCCAGG + Intronic
924511262 1:244730683-244730705 GCGCGCAGGCAAGGAGGCCCCGG - Intergenic
1062970798 10:1646886-1646908 GGTCGCAGGCACGCAGGCACTGG - Intronic
1067187901 10:44045526-44045548 GCTGGGAGGGATGGAGGTCCTGG + Intergenic
1069377937 10:67812873-67812895 GTAGCCAGGCACGGTGGCCCAGG + Intronic
1069405672 10:68095479-68095501 GATGGGAGGCAGGGAGACCCTGG - Intergenic
1069561818 10:69436012-69436034 CCTGGCAGGCCAGCAGGCCCAGG + Intergenic
1069858232 10:71453507-71453529 GCTGGCAGGCACGGAGGCATAGG + Intronic
1070160321 10:73862940-73862962 GATGGAAGAAACGGAGGCCCAGG + Intronic
1070716909 10:78729146-78729168 GGTGGAAGGCAGGGAGGGCCAGG + Intergenic
1073305524 10:102500789-102500811 TCTGCCAGGCACGGTGGCTCAGG + Intronic
1073469913 10:103716118-103716140 GCTGCCAGGGAAGGAGGGCCAGG - Intronic
1074603572 10:114938532-114938554 GCTGGCAGGTACTGCAGCCCGGG + Exonic
1075092331 10:119450818-119450840 GATGCCAGGAACAGAGGCCCTGG - Intronic
1075505018 10:123013767-123013789 GCCGGCAGGCCCTGCGGCCCCGG - Intronic
1075610998 10:123854590-123854612 GCTGGCAGGGAAGGAGCCCTGGG - Intronic
1076373164 10:129967695-129967717 GCTGGCACGCGCGGTGGCTCGGG - Intergenic
1076373871 10:129971166-129971188 GCTGGGCGGCAAGGCGGCCCAGG + Intergenic
1076449575 10:130547396-130547418 GATGGCAGGCACGTGGGCACTGG - Intergenic
1076615604 10:131752206-131752228 GCTGGCAGCCTCAGAGGCCGGGG + Intergenic
1076648781 10:131972768-131972790 GATGGCAGGCAGGGAGGGACAGG + Intronic
1076715218 10:132360566-132360588 GATGGGAGGCAGGGAGGACCAGG - Intronic
1076721814 10:132396446-132396468 GGTGGCCGGCACCGGGGCCCGGG - Intergenic
1077068679 11:657168-657190 GGTGCCAGGCAGGGAGCCCCAGG - Intronic
1077103858 11:833497-833519 CTTGGCAGGCGCGGAGTCCCAGG + Intronic
1077108456 11:851819-851841 GCAGGCAGGCAGGCAGGTCCTGG + Intronic
1077145624 11:1043022-1043044 GGGGGCAGCCACTGAGGCCCAGG + Intergenic
1077179442 11:1205715-1205737 GCTGGAAGCCACTGTGGCCCAGG - Intergenic
1077334713 11:1998145-1998167 GCTGGCAGGCAGGGAGCAGCAGG - Intergenic
1077335133 11:2000078-2000100 TCTGGCAGGCACAGAGCCCGGGG - Intergenic
1077335221 11:2000484-2000506 TCTGGCAGGCACAGAGCCCGGGG - Intergenic
1077336933 11:2009513-2009535 GCTGGAAGGGACAGAGGCCCAGG - Intergenic
1077443938 11:2581499-2581521 GCTGGCAGAGAGGGGGGCCCTGG - Intronic
1077471037 11:2760636-2760658 GCAGGAAGGCACTGAGGGCCCGG - Intronic
1077504274 11:2922865-2922887 CCTGCCAGGCCTGGAGGCCCCGG + Intronic
1077797549 11:5508123-5508145 GATGGCAGCCAGGGAGGCTCAGG + Exonic
1078102122 11:8336205-8336227 GCTGGCAGGGCAAGAGGCCCGGG - Intergenic
1078375507 11:10790206-10790228 GCTAGAGGGCACGGTGGCCCTGG + Intergenic
1079058550 11:17228291-17228313 GTTGGGGGGCCCGGAGGCCCTGG + Intronic
1079111165 11:17606002-17606024 GCAGGCAGGCCTGGTGGCCCTGG + Exonic
1081662164 11:44894778-44894800 GCAGCGAGGCACAGAGGCCCAGG - Intronic
1081726789 11:45335604-45335626 GCTGGAAGGCACAGAGGCAGGGG + Intergenic
1081810961 11:45913938-45913960 GCTGGGAGGCAGGGAGGACATGG + Exonic
1081845067 11:46234713-46234735 TCTGCCAGACAGGGAGGCCCAGG - Intergenic
1081866832 11:46364879-46364901 GCTGGCAGCCACAGAGGTCAAGG - Intronic
1081995224 11:47359555-47359577 GGTGGCAGACAGTGAGGCCCAGG + Intronic
1082877903 11:58006994-58007016 GTTCTCAGCCACGGAGGCCCAGG + Intergenic
1084182923 11:67455603-67455625 GCAGACAGGCCCCGAGGCCCCGG + Exonic
1084266711 11:68008769-68008791 GCCGGGAGCTACGGAGGCCCAGG + Intronic
1084422286 11:69066378-69066400 GCTGTCAGGCACAGAGCCACGGG - Intronic
1084973501 11:72783969-72783991 CCTGGCAGGCAGCCAGGCCCTGG + Intronic
1085313356 11:75529092-75529114 GCTGGCAGGGACGGAGGCAGAGG - Intergenic
1085446122 11:76602445-76602467 GCTGGCAGGGGCAGAGGCTCTGG - Intergenic
1085668994 11:78443551-78443573 TCTGTCAGGCGCCGAGGCCCAGG + Intronic
1085844520 11:80050068-80050090 GCTGCCTGACACAGAGGCCCTGG - Intergenic
1086306630 11:85486760-85486782 GTGGGCAGGCACTCAGGCCCTGG - Intronic
1089143713 11:116309107-116309129 GTTGGGCGGCATGGAGGCCCTGG - Intergenic
1089365668 11:117919505-117919527 CCTGGCAGGAGCCGAGGCCCAGG - Intronic
1089517336 11:119041630-119041652 GGGGGCAGGCACGGTGGCTCGGG - Intergenic
1089631906 11:119789248-119789270 GAAGGCAGGCAGGGAGGCCTGGG + Intergenic
1090693345 11:129209338-129209360 GCTGGATGGCACGGAGTCTCTGG + Intronic
1091300400 11:134503701-134503723 CCTGGCAGGCAGGCAGGCTCTGG - Intergenic
1202817696 11_KI270721v1_random:53327-53349 GCTGGCAGGCAGGGAGCAGCAGG - Intergenic
1202818116 11_KI270721v1_random:55260-55282 TCTGGCAGGCACAGAGCCCGGGG - Intergenic
1202818204 11_KI270721v1_random:55666-55688 TCTGGCAGGCACAGAGCCCGGGG - Intergenic
1202819917 11_KI270721v1_random:64695-64717 GCTGGAAGGGACAGAGGCCCAGG - Intergenic
1091394832 12:147662-147684 CCTGGCAGAAACTGAGGCCCTGG + Intronic
1091589708 12:1835992-1836014 GCTGGCAGGCAATGAGCCTCAGG - Exonic
1092282341 12:7108053-7108075 GATGGCAGCCCCGGAGGCGCTGG + Intronic
1092919573 12:13219065-13219087 GATGGAAGACAAGGAGGCCCTGG - Exonic
1093214539 12:16347749-16347771 GGTGGCAGGCAGGGAGGGCCAGG + Intronic
1094528978 12:31254404-31254426 TCTGCCAGGCAAGGAGCCCCGGG + Intergenic
1095277966 12:40312394-40312416 TCTGGCAGGCTCACAGGCCCTGG - Intronic
1096111557 12:49031924-49031946 GTTGGCAGCCCAGGAGGCCCTGG + Exonic
1096372909 12:51083508-51083530 GCCGGCAGGCAGAGAGGGCCGGG + Exonic
1097498410 12:60373088-60373110 TCTGGCAGGCACTGAGACGCAGG + Intergenic
1100362316 12:93890023-93890045 GCAAGAAGGCTCGGAGGCCCGGG - Intronic
1101874444 12:108589354-108589376 GCTGGCAGCTCCTGAGGCCCAGG + Intergenic
1102011833 12:109623868-109623890 GTTGGTATGCATGGAGGCCCTGG + Intergenic
1102566043 12:113798141-113798163 GCTGGCTGGGATGGAGACCCCGG - Intergenic
1102902410 12:116648569-116648591 GCTGGGAGGCAAGGTGGCCTTGG - Intergenic
1103107818 12:118246105-118246127 GCGGGGGGGCACGGAGGCCCTGG + Intronic
1103209517 12:119156441-119156463 GCGGGGAGGCACGGAGGGGCCGG + Intronic
1103412993 12:120725905-120725927 GCGGGCAGGGCCCGAGGCCCGGG - Exonic
1103426155 12:120836329-120836351 GCTGGCATGCAAGGAAGTCCAGG + Intronic
1103718369 12:122959794-122959816 GCGGCCAGGCACCCAGGCCCTGG - Exonic
1103888459 12:124220748-124220770 CCTGGCAGCCACCAAGGCCCAGG - Intronic
1104140568 12:125983321-125983343 GCTGGCAGGCACTCTGCCCCTGG - Intergenic
1104882354 12:132081338-132081360 GCTGGTAGGCATGGAGCCGCAGG - Intergenic
1105020625 12:132814303-132814325 GCTGCCGGGCACGGTGGCTCAGG - Intronic
1106352292 13:28943791-28943813 GCTGGAAGGCACAGTGGGCCTGG + Intronic
1108603650 13:52016453-52016475 CATGGCAGGCCTGGAGGCCCAGG + Intronic
1110569643 13:76990560-76990582 CCAGGCAGCCACGGAGGCTCTGG + Intergenic
1112879385 13:104087182-104087204 GATGGCAGGCAAAGAAGCCCAGG - Intergenic
1113091047 13:106617909-106617931 GCTGGCTGGCAGTGAAGCCCCGG - Intergenic
1113643153 13:111972641-111972663 GCTTGCAGGAACAGAGCCCCAGG - Intergenic
1115143427 14:30199621-30199643 GGTGGCAGGAATGGAGGCCATGG - Intergenic
1115154438 14:30321969-30321991 GCTGGCAGGCACACAGACACGGG - Intergenic
1117511183 14:56453140-56453162 GCTGGAAGGGTAGGAGGCCCAGG - Intergenic
1118254876 14:64196908-64196930 GCTGGCTGGCTCGCAGGCACAGG - Intronic
1118312699 14:64705097-64705119 GCTGGCAGGAGCCGAGGCTCGGG - Intronic
1119714931 14:76852497-76852519 GATGGCAGGATGGGAGGCCCTGG - Intronic
1121441466 14:93952361-93952383 CCTGGCAGGCACGGATTCCAGGG + Intronic
1121696357 14:95915603-95915625 GCTAGAAGGCACGGAGGTCATGG - Intergenic
1122089959 14:99331382-99331404 GCTGGCAGGCACAGAGGTACAGG - Intergenic
1122714510 14:103686972-103686994 GCTGGCAAGCAGGGCGGCCTTGG + Intergenic
1122882217 14:104695267-104695289 GCTGGCAGGCCCTCAGGCCCAGG + Intronic
1123016882 14:105379984-105380006 GCTGGGACTCAGGGAGGCCCGGG - Intronic
1123680279 15:22757962-22757984 GCTGGCAGCCCCGGTGCCCCAGG - Intergenic
1123923479 15:25087116-25087138 GCTGTCAGGCAAGGAGTCTCTGG + Intergenic
1124070707 15:26390701-26390723 GCTGGCAGGTACAGTGGACCTGG - Intergenic
1124332492 15:28832428-28832450 GCTGGCAGCCCCGGTGCCCCAGG - Intergenic
1124360971 15:29036186-29036208 TCTGTCAGGCACTGAGGCCTGGG - Intronic
1124439402 15:29675455-29675477 GCTGGCACCCAGGGAGGCCGAGG + Intergenic
1125406079 15:39353692-39353714 GATGGCAGGCTCGGGGGCCTTGG + Intergenic
1125761281 15:42097236-42097258 GCTGGCAGGCACAGCGGGGCTGG + Intergenic
1127176687 15:56365591-56365613 GGTGGCGGGAACGGAGTCCCTGG - Exonic
1128579480 15:68798815-68798837 GGTGGCAGGGAAGGAGGCCAAGG - Intronic
1128623057 15:69168492-69168514 GCTGGCAGGCATGGAGGAAGAGG + Intronic
1129107089 15:73317968-73317990 GCCGGCTGGGAAGGAGGCCCTGG + Intergenic
1129663480 15:77566318-77566340 GCTGGCAGGCAGGGAGCTGCGGG + Intergenic
1129691954 15:77718843-77718865 TGTGGCAGTCAGGGAGGCCCCGG - Intronic
1129794323 15:78364404-78364426 GCTGGCAGGCACCACGGCTCCGG + Intergenic
1131056385 15:89377771-89377793 GCTGGCAGGTAAGGAGCTCCAGG + Intergenic
1131114322 15:89784709-89784731 GCAGGCAGACATGGAGGCACAGG + Intergenic
1132410982 15:101578133-101578155 GCTGCCCAGCACGGAGACCCTGG - Intergenic
1132517488 16:372576-372598 GCTGGCTGGCACTGCTGCCCAGG - Intronic
1132575302 16:661202-661224 TCTGCCGGGCACGGTGGCCCTGG - Intronic
1132610529 16:813734-813756 GCAGGCAGGCAGGGGTGCCCCGG - Exonic
1132645828 16:998865-998887 GCAGGAAGGCCCGGAGGCCTGGG + Intergenic
1132709842 16:1261514-1261536 GCAGGCAGGCAGGGCGGGCCGGG + Intergenic
1134134965 16:11671872-11671894 GCTGGCAGGCAGGGAGGGAAGGG - Intronic
1136924506 16:34359545-34359567 GCTGGCAGGCAGGGAGAGCAGGG - Intergenic
1136980067 16:35052261-35052283 GCTGGCAGGCAGGGAGAGCAGGG + Intergenic
1137250570 16:46737753-46737775 GCTGGCAGCCCTGGAGGCCCTGG + Exonic
1138086714 16:54140139-54140161 GCCAGCAAGCTCGGAGGCCCAGG + Intergenic
1138554676 16:57764563-57764585 GATGGCTGGCAGGCAGGCCCAGG - Intronic
1138655699 16:58490121-58490143 GTAGGCAGGCACAGAGGCTCAGG - Intronic
1139573164 16:67825839-67825861 GCTGGCAGGCAGGCAGGGCCAGG + Intronic
1139890562 16:70251153-70251175 GCTGGCAGCCCTCGAGGCCCAGG + Exonic
1140054378 16:71512839-71512861 GGTGTGGGGCACGGAGGCCCAGG + Intronic
1140206907 16:72940498-72940520 GCAGGAAGACACGGATGCCCCGG + Intronic
1140862173 16:79027422-79027444 AATGGGAGGCAGGGAGGCCCAGG - Intronic
1141762748 16:86039327-86039349 AATGCCAGGCAGGGAGGCCCTGG - Intergenic
1141831695 16:86512702-86512724 GCAGGCAGGCAGGCAGGCCGTGG + Intronic
1142015072 16:87741271-87741293 GCTGGCCTGGACAGAGGCCCAGG + Intronic
1142196029 16:88739703-88739725 GCTGGGAGGCTCCGAGGCCAGGG + Intronic
1142287043 16:89175715-89175737 GCTGGCAGGCTCCGAGGCCAGGG + Intronic
1142291177 16:89194220-89194242 GCTGACAGCCACCGAAGCCCAGG - Intronic
1142358962 16:89617297-89617319 GTAGGCAGGCACCAAGGCCCAGG + Intronic
1142815725 17:2423632-2423654 GCGGGCTGGCAGGGAGGGCCAGG - Intronic
1142877098 17:2857769-2857791 GCTGGGAAGGACGGAGGCCGAGG + Intronic
1142964505 17:3572299-3572321 ACTGGCAGCCAGGGTGGCCCCGG - Intronic
1144763806 17:17722347-17722369 GCTGGCGGGCGCCGAGCCCCGGG - Intronic
1144793005 17:17872028-17872050 TCTGGCAGGCCCCAAGGCCCAGG - Intronic
1145023041 17:19446809-19446831 GCGGGGGGGCCCGGAGGCCCTGG - Intergenic
1145721041 17:27073044-27073066 GGTGGCAGCCATGGGGGCCCTGG - Intergenic
1146574441 17:33979058-33979080 GCTGGGAGGGACCAAGGCCCTGG - Intronic
1146943077 17:36857290-36857312 GCGGGCAGGCAGGCAGGCGCGGG - Intergenic
1147543725 17:41382172-41382194 GCTGGGGGGCACGCAGGGCCGGG + Exonic
1147545402 17:41397465-41397487 GCTGGGGGGCACGCAGGGCCGGG + Exonic
1147914247 17:43877288-43877310 GCTGGCAGCCAGGCAGGCCCGGG - Intronic
1148113743 17:45162466-45162488 CCTGGAAGTCACCGAGGCCCAGG - Exonic
1148765935 17:50038200-50038222 GCTGGCTGGCCTGGAGGCCGGGG - Intergenic
1149461493 17:56833541-56833563 GCGGGCGGGCGCGGAGGCCGAGG - Intronic
1149538694 17:57452379-57452401 GCTTGCAGGCAAGGTGGCCTGGG - Intronic
1149770376 17:59316197-59316219 TCTGCCCAGCACGGAGGCCCAGG - Intergenic
1150426212 17:65079012-65079034 ACAGCCAGGCACGGTGGCCCAGG + Intergenic
1151455579 17:74223766-74223788 GCTGGCAGCCAGGCAGGTCCTGG + Intronic
1151662514 17:75526138-75526160 GCGGGCAGAGACGGAGTCCCCGG + Intronic
1151679257 17:75615067-75615089 GCTGCCGGGCCCGGAGGCCCTGG - Intergenic
1151732602 17:75920273-75920295 GCTGGCAGAGCTGGAGGCCCAGG - Exonic
1152128236 17:78460176-78460198 GCTGGCAGCCCAGGAGGCTCTGG - Exonic
1152190205 17:78883559-78883581 GCTGGCAGGCGGTGTGGCCCCGG - Intronic
1152227970 17:79101524-79101546 ACTGGCTGGGACAGAGGCCCTGG - Intronic
1152621135 17:81365427-81365449 ACAGGCTGGCACGGAGGCCAGGG + Intergenic
1152668817 17:81589003-81589025 GCTGCCATGCAAGGACGCCCCGG - Exonic
1152736779 17:82001071-82001093 GCTGTCAGCCACAGAGGGCCGGG - Intronic
1152801089 17:82330999-82331021 GCTGGGAGGAAGGGAGGACCGGG - Intronic
1153688442 18:7568067-7568089 GCTGGCAGGCACCCAGTCCTCGG + Intronic
1153760119 18:8322779-8322801 GGTGGCAGCCATGGGGGCCCTGG + Intronic
1157496638 18:48161639-48161661 GCGGGCAGGCACGGAGTCCGGGG - Intronic
1158096487 18:53778184-53778206 GCTGCCAGGCACGGTGGCTCAGG + Intergenic
1158275236 18:55759686-55759708 AAGGGCAAGCACGGAGGCCCAGG + Intergenic
1159045860 18:63367656-63367678 GCTGGGTTGCTCGGAGGCCCCGG + Intergenic
1159920059 18:74219973-74219995 ACTGGCAGGCGCAGAGGGCCAGG - Intergenic
1160048861 18:75413067-75413089 GCTGGCAGTCGCTGAGGTCCAGG + Intronic
1160526122 18:79538843-79538865 ACAGACAGGCACGGAGGCCAAGG - Intergenic
1160751660 19:737254-737276 CCTGGCAGACACCGAGGCCCAGG + Intronic
1160855434 19:1215133-1215155 CCTGGCAGGCAGGAAGGCGCTGG + Intronic
1161237154 19:3203890-3203912 GTGGGGAGGCACGGAGGCCCAGG + Intronic
1161607574 19:5223226-5223248 GCTGGCACGCTGGGAGCCCCCGG - Exonic
1162378914 19:10320843-10320865 CCTGGCGGGTAAGGAGGCCCGGG - Exonic
1162463923 19:10829778-10829800 GGTGGCAGGGACTGAGGCCCAGG + Intronic
1162716551 19:12638079-12638101 GATCGCAGCCAGGGAGGCCCAGG - Intronic
1162762590 19:12897378-12897400 GCAGGCAGGCGTGAAGGCCCAGG - Exonic
1162775391 19:12975744-12975766 CCTGGCAGCCACGCAGCCCCTGG - Intergenic
1162833080 19:13298984-13299006 GCCTGGACGCACGGAGGCCCTGG - Exonic
1163159781 19:15457693-15457715 GCTGGCACGCACGGCGCCTCGGG - Exonic
1163287759 19:16359096-16359118 GCTGGCAGTCAGGGGGGCCCAGG - Intronic
1163290630 19:16377043-16377065 GCTGGTGAGCAGGGAGGCCCTGG + Intronic
1163594952 19:18215792-18215814 GCAGCCAGGCACGGTGGCTCAGG - Intronic
1163679313 19:18671517-18671539 GCTGGCAGGGGCGCCGGCCCAGG + Exonic
1164046138 19:21543773-21543795 GCGGCCAGGCACGGTGGCTCAGG + Intronic
1164729375 19:30490965-30490987 GTGGGCAGGCACTGAGGACCCGG + Intronic
1164826577 19:31288885-31288907 GATGTTAGGCAGGGAGGCCCTGG + Intronic
1165349175 19:35267268-35267290 GCTGGCGGGCCAGGCGGCCCCGG + Exonic
1165355087 19:35299585-35299607 GGTGGCAGGCACGGAGGTGGAGG + Exonic
1165714892 19:38037966-38037988 GATGGCAGGTAGGGATGCCCTGG + Intronic
1165863428 19:38921493-38921515 GCTGGGTGGCAGGGAGGCCAGGG - Intronic
1166086942 19:40482519-40482541 CCTGGCAGGAATGGAGGTCCAGG + Intronic
1167356315 19:49006434-49006456 GCAGGCAGGCAGGCAGGCACTGG - Intronic
1167492388 19:49800214-49800236 GCTGGCAGGCGCCACGGCCCCGG - Intronic
1168316464 19:55486764-55486786 GCTGGCCTTCGCGGAGGCCCGGG + Exonic
926234034 2:11026113-11026135 GCTGGGAGGGTTGGAGGCCCAGG + Intergenic
927216127 2:20668703-20668725 GCTGGCAGGGATGGATGACCTGG - Intronic
927512280 2:23651577-23651599 GGTGACAGGCAAGGTGGCCCAGG + Intronic
927512429 2:23652615-23652637 GGTGACAGGCAAGGTGGCCCAGG + Intronic
928279123 2:29928904-29928926 GAAGGCAAGGACGGAGGCCCAGG - Intergenic
928484656 2:31717958-31717980 TCAGGCAAGCACGGAGACCCAGG + Intergenic
929795232 2:45053978-45054000 GCTGGCCAGCAAGGAGGGCCTGG - Intergenic
930506229 2:52285615-52285637 GCAGCCAGGCACGGTGGCTCAGG + Intergenic
932592501 2:73075759-73075781 GCAGGCAGGCAGGCAGGCCTAGG - Intronic
932756674 2:74414565-74414587 GCTGGCAGACAGGGAGGGCCAGG - Exonic
933891100 2:86770864-86770886 TCTGACAGGCACTGAGGCTCTGG + Intronic
933903380 2:86865346-86865368 GCAGCCAGGCACGGTGGCTCAGG + Intergenic
934649859 2:96084668-96084690 GCTGCCAGGGAGGGAGGCCCTGG - Intergenic
934925158 2:98377141-98377163 GCTGGTTAACACGGAGGCCCTGG - Intronic
934930359 2:98417270-98417292 GCTGGTAGGTAAGGAGGCCATGG - Intergenic
935777134 2:106483613-106483635 GCAGCCAGGCACGGTGGCTCAGG - Intergenic
936493526 2:112996728-112996750 TCAGGCATGCACAGAGGCCCAGG - Intergenic
937215113 2:120307704-120307726 GCTGGCAGGGAAGGGAGCCCCGG - Intergenic
937218648 2:120328735-120328757 TGGGGCAGGCAGGGAGGCCCGGG - Intergenic
937323218 2:120973330-120973352 GCAGGCAGGCACTGAGCACCTGG + Intronic
937931038 2:127205373-127205395 GCGGCCAGGCAGGGAGGCCCAGG - Intronic
938370205 2:130763701-130763723 GCTGGGGGGCAGGGAGGGCCTGG + Exonic
939233614 2:139463510-139463532 TCTGGCAGGCACAGTGGCTCAGG + Intergenic
940112660 2:150171290-150171312 GCCGGCCGGCCCGGAAGCCCCGG - Intergenic
942346028 2:175004641-175004663 GCTGGGAGGCTCAGAGGTCCTGG - Intronic
944244252 2:197515856-197515878 ACTGGCAGGGACTGAGGCACCGG - Exonic
944412641 2:199458500-199458522 GCAGGCGGGCACCGGGGCCCAGG + Intronic
944692278 2:202169059-202169081 GCTGGCAGGCAGGGGGTCCCTGG + Intronic
945069632 2:205977324-205977346 GCCGGCAGGCCCGCAAGCCCTGG + Intergenic
945119627 2:206443952-206443974 GCTGGCAGGCACCGAGCCGGCGG - Exonic
946175316 2:217918916-217918938 GCTGGGCAGCACTGAGGCCCGGG + Intronic
946302812 2:218834651-218834673 GCAGGCAGGCAGGCAGGCACGGG + Intergenic
947445070 2:230157014-230157036 GATGACAGGCACAGAAGCCCAGG - Intergenic
947592949 2:231395635-231395657 GCCGGCAGGGGCGGTGGCCCAGG - Exonic
947741161 2:232485609-232485631 TCTGGCAGGCAGTGAGGGCCAGG - Intronic
948118654 2:235512729-235512751 GCAGGCAGGGTGGGAGGCCCAGG - Intronic
948140882 2:235670916-235670938 GCGCGCAGGGACGGGGGCCCGGG + Intronic
948226027 2:236309997-236310019 GCGGGCAGGCACGGGTGCACAGG - Intergenic
948245964 2:236486156-236486178 GCTGGCATGAACTGTGGCCCAGG + Intronic
948353551 2:237360000-237360022 GCTGCCAGGGAGGGAGGCGCTGG - Intronic
948386430 2:237583815-237583837 GCTTGGAGGAAGGGAGGCCCTGG + Intronic
948733808 2:239985023-239985045 TCTGGCAGGCATGGAGGTCAGGG - Intronic
948735778 2:240004041-240004063 TCTGGCAGGCACAGTGACCCCGG - Intronic
948851991 2:240713064-240713086 ACTGGCTGGCACGGGGGCTCCGG - Intergenic
948983892 2:241508522-241508544 GCTGGGAGGCCCGGGGTCCCCGG - Exonic
949004217 2:241636533-241636555 GCTGTCAGCTACGGAGGCGCAGG + Intronic
1169006035 20:2207725-2207747 GCTCGCTGGCACGGAGCTCCCGG + Intergenic
1169453297 20:5730618-5730640 GCTGGAAGGCAGTGAAGCCCAGG - Intergenic
1170885131 20:20334072-20334094 GCTGCCAGGCAAGGGAGCCCAGG + Intronic
1171011672 20:21512578-21512600 GCTGCCAGGCGCGGAGGTCCAGG - Intronic
1171189908 20:23151431-23151453 TCCGGCAGGCACAAAGGCCCAGG - Intergenic
1171448563 20:25221146-25221168 GCTAGGAGTCGCGGAGGCCCTGG - Intronic
1172167951 20:32910337-32910359 GTAGGAAGGGACGGAGGCCCAGG + Intronic
1172484937 20:35292288-35292310 GCAGGCATGTTCGGAGGCCCGGG - Exonic
1173255658 20:41392950-41392972 CATGGCAGGCATGGAGCCCCAGG + Intergenic
1173769047 20:45641327-45641349 GCGGGGAGGCCCGGAGGCCCTGG - Intergenic
1173809067 20:45945442-45945464 GCTGTCAGGCAAGAAGGCTCAGG - Intronic
1174137860 20:48393015-48393037 CCAGGCAGCCAAGGAGGCCCAGG - Intergenic
1174546231 20:51327307-51327329 GCGGTCAGGCACGGTGGCTCAGG - Intergenic
1175108229 20:56629224-56629246 GGGGGCCGGCGCGGAGGCCCAGG - Intergenic
1175196002 20:57243780-57243802 GCTGAGAGGGAAGGAGGCCCAGG - Intronic
1175448448 20:59042647-59042669 GAGGGCAGGCACGCCGGCCCTGG - Intronic
1175644059 20:60656606-60656628 GCAGGCAGGCAGTGATGCCCAGG + Intergenic
1175900956 20:62359748-62359770 GCTGGCACTCCCGGGGGCCCAGG + Intronic
1175974576 20:62704087-62704109 ACTGGCAGGCTGGGAGGCTCAGG - Intergenic
1176071852 20:63231091-63231113 GCGGGCAGGCACCTAAGCCCTGG - Intergenic
1176201472 20:63862764-63862786 GCTGGAGGGCGAGGAGGCCCTGG + Exonic
1176381588 21:6116616-6116638 GCTGGCAGGCACGGAGGGTCCGG + Exonic
1176381601 21:6116659-6116681 GCTGGCAGGCACGGAGGGTCTGG + Intronic
1176381613 21:6116702-6116724 GCTGGCAGGCACGGAGGGTCCGG + Intronic
1176381625 21:6116745-6116767 GCTGGCAGGCACGGAGGCCCCGG + Intronic
1178703463 21:34853477-34853499 GCTGGCACGCACCGATGCCAGGG - Intronic
1179150551 21:38805555-38805577 GCCGGCTGGCCCTGAGGCCCCGG - Exonic
1179166995 21:38943158-38943180 GCAGGCAGGCACTGAGCCCTGGG + Intergenic
1179595166 21:42438398-42438420 GCTGTCAGGCAGAGGGGCCCAGG + Intronic
1179741847 21:43421494-43421516 GCTGGCAGGCACGGAGGCCCCGG - Intronic
1179741859 21:43421537-43421559 GCTGGCAGGCACGGAGGGTCCGG - Intronic
1179741871 21:43421580-43421602 GCTGGCAGGCACGGAGGGTCTGG - Intronic
1179741884 21:43421623-43421645 GCTGGCAGGCACGGAGGGTCCGG - Exonic
1180148238 21:45933891-45933913 GCTGGCAGGGACGGGGGGCAGGG + Intronic
1180709994 22:17832974-17832996 GCTGGCAGGAGCGATGGCCCTGG - Intronic
1180919894 22:19516248-19516270 GCTGGTAGACAAGGAGGCTCGGG + Intronic
1181635421 22:24172158-24172180 ACTGGCAGCCTCGGTGGCCCTGG + Intronic
1181662448 22:24362250-24362272 GCTGGCAGGGAAGCAGGTCCTGG + Intronic
1181766281 22:25094456-25094478 GGTGGGAGGCAAGCAGGCCCTGG + Intronic
1181934392 22:26428709-26428731 GCTGGCAGGGACGGGGACCCAGG + Intergenic
1182623426 22:31630175-31630197 GCAGGCAGCCCAGGAGGCCCTGG + Intronic
1183227212 22:36558752-36558774 GCTGGAAGGTCTGGAGGCCCTGG + Intergenic
1183359495 22:37376099-37376121 GCTTGCTGGCACAGAGGCCCTGG - Intronic
1183460065 22:37944464-37944486 CCTGGCTGACATGGAGGCCCTGG - Exonic
1184106029 22:42368101-42368123 GCTGGGATGCAGGGAAGCCCTGG - Intergenic
1184294923 22:43517156-43517178 GCTGGCAGGTGCCAAGGCCCTGG + Intergenic
1184403993 22:44289661-44289683 GGTGGCAGGCGGGGACGCCCAGG + Intronic
1184493720 22:44825418-44825440 GCTGGCAGCCACGGAGGCGCTGG - Intronic
1184566322 22:45294163-45294185 GCAGGGAGGCAGGGAGGCCCAGG + Intronic
1184573129 22:45339685-45339707 GCTGACAAGAACGAAGGCCCGGG + Intronic
1184685861 22:46096054-46096076 GGTGGCAGGCAGGGGGACCCAGG + Intronic
1184827682 22:46964061-46964083 GCTGGCAGCCAAGGAGGGGCAGG - Intronic
1185223240 22:49639634-49639656 GCTTCCAGACACAGAGGCCCTGG + Intronic
949767013 3:7537732-7537754 GCTGGCAGGGAAGGTGACCCAGG + Intronic
949947601 3:9202723-9202745 GCTGCGAGGCACAGAGTCCCAGG - Intronic
949947870 3:9204375-9204397 GGTGGCAGTCAGGGAGGCCTGGG - Intronic
950474971 3:13209447-13209469 GCTGGCATGCATGGAGGCCTTGG - Intergenic
950509802 3:13419566-13419588 GCGGGGAGGAACGGAGACCCTGG - Intronic
950569907 3:13793420-13793442 CCTGGCTGGCACAGGGGCCCGGG - Intergenic
952816925 3:37453657-37453679 GGTGGCAGGCAGGGAGGTCGAGG + Intronic
953223785 3:40998385-40998407 GTCGACAGGTACGGAGGCCCAGG - Intergenic
953913395 3:46904027-46904049 GCTGGCAGCAACGGAGGCTGAGG - Intergenic
954483256 3:50821579-50821601 GCGGCCAGGCACGGTGGCTCAGG - Intronic
954636020 3:52071295-52071317 GGTGGCAGGCCAGGAGGTCCTGG - Intergenic
954684589 3:52363513-52363535 GCTGGGAGGCTCGGAGGGCCTGG - Intronic
957131594 3:76229996-76230018 GCAGGCAGGAAAGGAGACCCTGG + Intronic
960868602 3:122227440-122227462 GCTGGCTGGCCCGCAAGCCCCGG - Intronic
960942312 3:122943055-122943077 GCTGGCCGGCAGGGGGCCCCTGG + Intronic
961005475 3:123402455-123402477 GCTGGAAGCCAAGGGGGCCCAGG + Intronic
961616700 3:128188344-128188366 GCTGGCAGGCAGGCAGGCTGAGG + Intronic
961780794 3:129319106-129319128 GCTCGCAGCCACGGTGCCCCGGG + Intergenic
961789580 3:129366004-129366026 GCTGGCGTGCACGGAGGCCTTGG + Intergenic
962290594 3:134133398-134133420 GGTGGGAGGCAGGGAGGACCAGG + Intronic
964887662 3:161503157-161503179 CCTGGCCTGCACGGAGGGCCTGG + Exonic
966469691 3:180275048-180275070 GAGGGCAGGCAGGGAGGCCTGGG + Intergenic
966876938 3:184327755-184327777 GCTGGCAGGCATAGGGGTCCGGG + Intronic
968549121 4:1213429-1213451 GCTGGCAGGAAGGGACCCCCAGG + Intronic
968571770 4:1346071-1346093 GCTGGGAGCCACTGACGCCCAGG + Intergenic
968628133 4:1637277-1637299 ACTGGCTGGCTCTGAGGCCCTGG + Intronic
968726537 4:2250505-2250527 GCTGGCGGGCAGGCAGGCCAAGG + Exonic
968879226 4:3290672-3290694 CCTGGCAGGCACGGAAGAGCAGG + Intergenic
968909030 4:3467230-3467252 GCAAGCAGGCATGGTGGCCCAGG - Intronic
968943897 4:3653660-3653682 GACGGCAGGCACAAAGGCCCTGG - Intergenic
969304792 4:6319426-6319448 GCAGGCATGTGCGGAGGCCCAGG - Intergenic
969412901 4:7041528-7041550 GCTGGCAGAAATCGAGGCCCAGG - Exonic
969453083 4:7286038-7286060 GGAGGCAGGCAGGGAGCCCCCGG - Intronic
969872801 4:10115455-10115477 TCTGGCTGGCCCAGAGGCCCGGG + Intronic
975395453 4:73869329-73869351 GCTGGAAAGCCCGGAGCCCCCGG - Intergenic
975415430 4:74099237-74099259 GCTGGAAAGCCCGGAGTCCCGGG + Exonic
979238098 4:118424212-118424234 GCTGGCAGGCACTGAGTCTGGGG - Intergenic
980499029 4:133624939-133624961 GCTGGCAGAGAGGGAGGCCAGGG + Intergenic
981317039 4:143350074-143350096 GCGGGAGGGCCCGGAGGCCCTGG - Intronic
983027419 4:162755531-162755553 GGTGGCAGGCATGGAGACCATGG - Intergenic
983636796 4:169905878-169905900 GCGGCCAGGCACGGTGGCTCAGG - Intergenic
983937150 4:173509835-173509857 GCTGGAAGGCAAGGAAGCCGAGG + Intergenic
984849532 4:184142058-184142080 GCTGGCAGGCCGGGAGACCTTGG - Intronic
985602298 5:841549-841571 GCTGGCAGGCTCTGTGACCCCGG - Intronic
985685809 5:1280916-1280938 GCTGTCAGCCACAGATGCCCAGG - Intronic
985815544 5:2125398-2125420 GCTGGCTGGCTGGGAGACCCAGG + Intergenic
986315330 5:6583136-6583158 GCTGCCGGGCTCCGAGGCCCGGG - Intergenic
986391274 5:7289942-7289964 GCTGGCAGCCCCGGTGCCCCAGG - Intergenic
986492006 5:8302705-8302727 GCTGTCAGGCAAGAAGGCCATGG - Intergenic
988855930 5:35228532-35228554 GCTGGATGGCAGGGAGGCCAAGG - Intronic
990359774 5:55007030-55007052 TCAGGCATGCACAGAGGCCCAGG + Intronic
992202141 5:74395145-74395167 GCTGGCAGGCACCCAGCCTCAGG - Intergenic
993793621 5:92237782-92237804 GCTGGCAGGCACAGGGCTCCTGG + Intergenic
995733005 5:115265468-115265490 CCTGGGAGGCCCGGAGGCCCGGG - Intergenic
995831694 5:116361573-116361595 GCAGGCAGGCAAGGAGCCGCCGG - Intronic
997248228 5:132369717-132369739 GCTGGCAGGCAGAGCGGCGCCGG - Intergenic
997578959 5:135005287-135005309 GCAGGCATGCACAGAGACCCTGG + Intronic
998156372 5:139789052-139789074 GCAGGGAGCCACGGAGGCCTGGG - Intergenic
998529895 5:142874814-142874836 GCTGGCAGGCTTCCAGGCCCCGG - Intronic
999228587 5:150047870-150047892 GCTGGCAGTCAGGGATGCCTAGG + Intronic
999450747 5:151676060-151676082 GCTGGCAGGCTCAGAACCCCTGG + Intronic
1000128222 5:158268454-158268476 GCTGGCAGCGACAGTGGCCCTGG - Intergenic
1000300970 5:159955579-159955601 GCTGGCTGGCAGAGAGGCACAGG - Intronic
1000889327 5:166784760-166784782 GCTGGCAGGCCCGCAAGCCCAGG - Intergenic
1001054966 5:168441809-168441831 GCTGGCAGGCCCTGAGGCAGGGG - Exonic
1001589906 5:172858165-172858187 ACTGAGAGGCAGGGAGGCCCAGG + Intronic
1001590469 5:172861124-172861146 GCTGGCACGCAGGGAGGGGCAGG - Intronic
1001639751 5:173236075-173236097 GCTGCCAGGCAGGGAGGGCACGG - Intergenic
1001889898 5:175330123-175330145 GCTGGCAGGCACAAGGGCTCGGG - Intergenic
1003178473 6:3771735-3771757 GCTGGCTGGCCCGCAAGCCCCGG + Intergenic
1003310744 6:4967898-4967920 GCTTGCAGGGAGGGAGGCTCTGG + Intergenic
1003494548 6:6652719-6652741 GCTGGGAGGCCAGGAGGCCAGGG - Intronic
1006100997 6:31686373-31686395 CCTGCCAGGGACGGAGGGCCAGG - Intergenic
1006751506 6:36380835-36380857 AGGGGCAGGCAAGGAGGCCCTGG - Intronic
1006922717 6:37637184-37637206 GAGGCCAGGCACTGAGGCCCTGG - Exonic
1007105352 6:39279868-39279890 GCTGGCAAGCAGGGTGGCCTTGG + Intergenic
1007383296 6:41504149-41504171 GCTGGGAGGCCCGGGCGCCCCGG - Intergenic
1007430052 6:41771308-41771330 GCAGGCTGGGACAGAGGCCCTGG + Exonic
1007477528 6:42128873-42128895 ACTGGGAGACACGCAGGCCCTGG - Intronic
1007572838 6:42905639-42905661 GCTGGCAGGAAAGGAGGCAATGG - Intergenic
1007615730 6:43179016-43179038 GTTGGCAGGCAGGGAAGCCAGGG + Intronic
1007902130 6:45422346-45422368 GCTGGCGGGTAGGGAGACCCGGG - Intronic
1007910334 6:45506935-45506957 GTTGCCAGGCACGGTGGCTCAGG - Intronic
1011643078 6:89433248-89433270 GCTGGGCGGCGCCGAGGCCCTGG + Intronic
1012616228 6:101283062-101283084 TCAGGCAGGCACAGAGGCCCAGG + Intergenic
1015995228 6:138989707-138989729 GATGGCAGGAACAAAGGCCCTGG - Intergenic
1017388430 6:153911976-153911998 GGTGGCAGGCATGGAGACCATGG + Intergenic
1018050726 6:160005909-160005931 GCGGGGAGGCACGGCGGCCGAGG - Intronic
1019509021 7:1407959-1407981 GGTGGCAGGCACTGGGGCCGAGG + Intergenic
1019514753 7:1434784-1434806 TCCTGCAGGCTCGGAGGCCCAGG - Intronic
1019639288 7:2094659-2094681 GCTGGCAGGTGAGAAGGCCCCGG + Intronic
1019707013 7:2501780-2501802 GCTGGCAGGGGAGGAGGGCCGGG - Intergenic
1020099766 7:5388435-5388457 CTTGGCAGGCACGTAGGCGCGGG + Exonic
1020418167 7:7969303-7969325 GCCGGCCGACACGGAGGCGCGGG - Exonic
1021080463 7:16358048-16358070 GCTGGCAGGCACAGAGCCATAGG + Intronic
1021106442 7:16644946-16644968 TCTGGAAGCCAGGGAGGCCCTGG + Intronic
1021602197 7:22375474-22375496 TCTGGCAGGCAAGCAGGCCCAGG - Intergenic
1022606098 7:31815653-31815675 GCTGGCAGGCAGGCAGGCACTGG + Intronic
1022785352 7:33632449-33632471 GCTGGAGGGGACAGAGGCCCGGG - Intergenic
1024045077 7:45580391-45580413 GCAGAGAGGCAGGGAGGCCCCGG - Intronic
1024423781 7:49202016-49202038 GCTGGGAGGCAAGAAAGCCCAGG + Intergenic
1025127455 7:56355328-56355350 CCTGTCAGGCCCCGAGGCCCTGG - Intergenic
1025606536 7:63043855-63043877 GCTGGCAGCTGCGCAGGCCCAGG - Intergenic
1026640988 7:72125427-72125449 GATGGCAAGCACGCAGGCCAGGG - Intronic
1026760615 7:73123218-73123240 CCTGGCAGGCTCAGAGGCTCAGG - Intergenic
1026806776 7:73433927-73433949 GCGGGCAGGCACCGGGGCGCGGG + Exonic
1027036959 7:74932039-74932061 CCTGGCAGGCTCAGAGGCTCAGG - Intergenic
1027048394 7:75006453-75006475 GCTGGCAGGAGAGGAGGCCAGGG + Intronic
1027086605 7:75269420-75269442 CCTGGCAGGCTCAGAGGCTCAGG + Intergenic
1029650250 7:101886594-101886616 TCTGGCAGGCACGGGGGCCAGGG - Intronic
1030261573 7:107570485-107570507 GCTGGCAGGCATGGAAGTCCAGG + Intronic
1032088057 7:128893944-128893966 GCTGCCTGGCAGGGAGGGCCTGG - Intronic
1034385514 7:150737656-150737678 GGTGGCAGTCACTGAGGCTCTGG - Exonic
1035634830 8:1136736-1136758 GCTGGCAAACATGGAGGCCAGGG + Intergenic
1035699451 8:1626933-1626955 CCAGGCTGGCACGGAGGCCCCGG + Intronic
1035813406 8:2512823-2512845 GCTGCAAGGCACAGAGGCCTGGG + Intergenic
1036195296 8:6708553-6708575 GGTGGCGGGCGCGGCGGCCCGGG + Exonic
1036195310 8:6708598-6708620 GCTGGCCGCGACTGAGGCCCGGG + Exonic
1036216434 8:6883662-6883684 GCTGCCAGGAATGGAGTCCCCGG - Intergenic
1036632640 8:10526033-10526055 GATGGGAGCCACAGAGGCCCAGG - Intronic
1036642142 8:10591386-10591408 GCTGGCAGGGGCAGAGGCACAGG - Intergenic
1036660408 8:10704712-10704734 GCTGTCAGGCACGGAGGACCCGG + Intronic
1036778401 8:11629109-11629131 GCTGGCAGCTGCGCAGGCCCAGG + Intergenic
1037611953 8:20483300-20483322 GGTGGCAGGCAGGGAGGCAGGGG + Intergenic
1037776812 8:21841009-21841031 GCTGGCAGCCAGGGAGGACAGGG - Intergenic
1037828762 8:22176375-22176397 CCTGCCAGGCACGGAGGCGTGGG + Intronic
1038282083 8:26174795-26174817 GCTGGCAGGAAGGAAGTCCCAGG + Intergenic
1039702682 8:39978398-39978420 GCTGTCAGGCAGGGCAGCCCCGG + Intronic
1039743646 8:40404562-40404584 GGTGCCAGGCAAGGAGGACCAGG + Intergenic
1040474570 8:47764738-47764760 GCAGGCAAGGAGGGAGGCCCCGG + Intergenic
1042218867 8:66453658-66453680 GCTGGCCGGCAGGTAGCCCCGGG + Intronic
1043450006 8:80356973-80356995 CCAGGCAGGCACGGTGGCTCGGG - Intergenic
1044659737 8:94583197-94583219 GCTGGCAGGGGCTCAGGCCCTGG - Intergenic
1048198913 8:132355305-132355327 GAGGGGAGGCACAGAGGCCCTGG - Intronic
1049085138 8:140472734-140472756 GCTGCCAGGCGCGGTGGCTCAGG + Intergenic
1049283773 8:141763611-141763633 GGTGGGAGGGACAGAGGCCCTGG - Intergenic
1049360519 8:142210589-142210611 GCTGCCAGGGAGGGAGGACCAGG - Intergenic
1049696005 8:143984672-143984694 GCTGGCAGGGCAGGAGGGCCTGG - Exonic
1050358299 9:4804161-4804183 GCTGGGTGGCACAGAAGCCCAGG + Intronic
1052442240 9:28512037-28512059 GATGGCAGGCGTGGAGGCCATGG + Intronic
1052633636 9:31071930-31071952 GCTTGCACACTCGGAGGCCCAGG - Intergenic
1057229169 9:93308530-93308552 GCTGCAAGACATGGAGGCCCAGG + Exonic
1057230159 9:93317107-93317129 GCTGGCAGGAGCAGAGCCCCAGG - Intronic
1057891634 9:98874294-98874316 GCAGCCAGGCAGGGAGGCGCTGG - Intergenic
1058843346 9:108932621-108932643 GCAGCCAGGCACGGTGGCTCAGG - Intronic
1060000304 9:119952615-119952637 GCAGGCAGGCAAGCCGGCCCAGG + Intergenic
1060817878 9:126644923-126644945 GCTGACAAGGACGGAGGGCCTGG + Intronic
1060973099 9:127749917-127749939 AATGGGAGGCACAGAGGCCCAGG + Intronic
1060990355 9:127845407-127845429 TCTGGCTGCCACGGGGGCCCAGG + Intronic
1061067232 9:128286109-128286131 GTTGGCAAGCTGGGAGGCCCAGG - Intronic
1061425118 9:130493744-130493766 GCAGGCAGGCAGGCAGGCCATGG - Intronic
1061445663 9:130635879-130635901 GCTGGAAGGCAGGGAGGTCTGGG - Intronic
1061553297 9:131350238-131350260 GCTGACAGGCAGGAAGGCCCGGG + Intergenic
1061816356 9:133199734-133199756 GGAGCCAGGGACGGAGGCCCAGG + Intergenic
1061882536 9:133575327-133575349 TCAGGCAGCCAAGGAGGCCCAGG + Exonic
1061888705 9:133606331-133606353 GCTGGCAAACACTGAGGCCTCGG + Intergenic
1061934254 9:133848650-133848672 GCTGGCAGGCACGGGCCCCTGGG + Intronic
1061951430 9:133938453-133938475 GCTGGCAGGTGCAAAGGCCCTGG - Intronic
1062003427 9:134228022-134228044 GAGAGCAGGCAGGGAGGCCCCGG + Intergenic
1062050128 9:134442893-134442915 GATGGCAGGGACGGAAGCACAGG - Intergenic
1062081071 9:134623705-134623727 CCTGGCAGGCATGGGGGCCGAGG + Intergenic
1062096224 9:134705380-134705402 GCTGGGAGGCAGTGAGGGCCTGG - Intronic
1062282776 9:135759386-135759408 CCCGGCAGGCAGGGAGGCTCCGG + Intronic
1062525794 9:136977638-136977660 GCAGGCAGCACCGGAGGCCCAGG + Exonic
1062533556 9:137011952-137011974 GCTGGCCGGCACGAAGGACATGG + Exonic
1062562540 9:137148004-137148026 GCTCGCAAACACCGAGGCCCGGG - Intronic
1062576586 9:137211756-137211778 GCTAGCAGACAGGGAGGCCCTGG - Intronic
1185836006 X:3346465-3346487 GCAGGCAGACACGGCAGCCCTGG + Intronic
1188099998 X:26071642-26071664 TCAGGCAGGCACGGAGACACAGG - Intergenic
1188242549 X:27809236-27809258 GCTGGCAGGCCCCCCGGCCCAGG + Intronic
1190060705 X:47209958-47209980 GCTGGCAGGCACTCAGCCCTTGG + Exonic
1192235667 X:69294077-69294099 GCTGGCAGGCAGGCAGGTCAAGG + Intergenic
1194264059 X:91733915-91733937 TTGGGCAGGCACGGAGACCCAGG - Intergenic
1194375158 X:93123172-93123194 GCTGCCAGGCAAGGAGAGCCTGG - Intergenic
1194914192 X:99685114-99685136 TCAGGCAGGCACAGAGACCCAGG + Intergenic
1194975516 X:100392674-100392696 TCTGCCAGGCACAGAGGCCATGG - Intronic
1195570337 X:106393162-106393184 GCTGGCAGGAAAGGGGGCCTGGG - Intergenic
1199285109 X:146046419-146046441 GCCGGCGGGCCCGCAGGCCCCGG - Intergenic
1199478536 X:148273209-148273231 TCAGGCATGCATGGAGGCCCAGG + Intergenic
1199478542 X:148273236-148273258 TCAGGCATGCATGGAGGCCCAGG + Intergenic
1199990751 X:152986480-152986502 GCTGGCACGCACCAAGGGCCTGG + Intergenic
1200033840 X:153315954-153315976 GCTGGCACGCACCAAGGGCCTGG + Intergenic