ID: 1176382822

View in Genome Browser
Species Human (GRCh38)
Location 21:6121527-6121549
Sequence CAGTGTCCGTGCCAGGATGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 2, 1: 0, 2: 2, 3: 15, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176382822_1176382824 2 Left 1176382822 21:6121527-6121549 CCTGCATCCTGGCACGGACACTG 0: 2
1: 0
2: 2
3: 15
4: 170
Right 1176382824 21:6121552-6121574 TCTTACAGCAATAACTTCAGAGG 0: 2
1: 0
2: 0
3: 15
4: 166
1176382822_1176382825 5 Left 1176382822 21:6121527-6121549 CCTGCATCCTGGCACGGACACTG 0: 2
1: 0
2: 2
3: 15
4: 170
Right 1176382825 21:6121555-6121577 TACAGCAATAACTTCAGAGGAGG 0: 2
1: 0
2: 3
3: 11
4: 128
1176382822_1176382826 18 Left 1176382822 21:6121527-6121549 CCTGCATCCTGGCACGGACACTG 0: 2
1: 0
2: 2
3: 15
4: 170
Right 1176382826 21:6121568-6121590 TCAGAGGAGGTGAAGACATCTGG 0: 2
1: 0
2: 1
3: 21
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176382822 Original CRISPR CAGTGTCCGTGCCAGGATGC AGG (reversed) Exonic
902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG + Intronic
903007202 1:20306592-20306614 CAGTGTCCTTGGGAGGCTGCTGG + Intronic
904428711 1:30448110-30448132 CAGTGTGCGTGCCATGGTCCTGG + Intergenic
904641878 1:31937713-31937735 GAGTGTCCGTGCGAGGAGGTGGG - Intronic
904893113 1:33794131-33794153 CAGGGTCCCTGGCAGGATGTGGG - Intronic
905641833 1:39595332-39595354 CAGTGTCAGCTCCAGGATTCAGG - Intergenic
906242290 1:44249429-44249451 CAGTGTCTGTGCCAGGGCCCAGG + Intronic
911782412 1:101899062-101899084 CAGTTTCCGTGCCAGGAATCTGG + Intronic
911819691 1:102401561-102401583 CAGTGAACTTCCCAGGATGCGGG - Intergenic
912519534 1:110235584-110235606 CAGTGACCGTTTCAGGCTGCTGG + Intronic
912775985 1:112506826-112506848 CAGTTTCTGTGCCAGGAAGTCGG + Intronic
924199198 1:241641373-241641395 CAGTGTCCAGGACAGGCTGCAGG - Intronic
924314746 1:242784284-242784306 CTGTTTCCTGGCCAGGATGCTGG + Intergenic
924798149 1:247307996-247308018 AAGATTCTGTGCCAGGATGCTGG + Intronic
1062763397 10:44629-44651 CAGAGGCCCTGCCTGGATGCTGG + Intergenic
1065382422 10:25103286-25103308 CAGTGTCCCTGCAAGGATGGGGG - Intergenic
1067187894 10:44045508-44045530 CAGTGTGAGGACCAGGATGCTGG + Intergenic
1070728327 10:78807671-78807693 CAGTCTCCAAGGCAGGATGCTGG + Intergenic
1075096597 10:119475430-119475452 GAGTGTCCGTGTCAGCATCCTGG - Intergenic
1076533724 10:131162299-131162321 CAGTGTCGGTGGCAGGCTCCTGG - Intronic
1076877914 10:133225617-133225639 GAGTGTCCTTTCCAGGAAGCAGG - Exonic
1077890499 11:6414729-6414751 CAGTGTCTGTGCCAAGATGTTGG - Intronic
1078599962 11:12721459-12721481 TAGTGTCAGCTCCAGGATGCTGG - Intronic
1079019210 11:16895250-16895272 CAGTGTCCATGCCTGATTGCTGG - Intronic
1083780777 11:64916271-64916293 CAGTGTCCCTGCCTGGAGGGAGG - Intronic
1084888325 11:72224509-72224531 AAGTGTCGGGGCCAGGATGGGGG + Intronic
1085301955 11:75463835-75463857 CAGTGGCCCTTCCAGGTTGCAGG - Intronic
1087171911 11:95057941-95057963 CAGAATCCTTGGCAGGATGCTGG - Intergenic
1089289943 11:117431573-117431595 CAGTGACCGTGACACCATGCTGG + Exonic
1091099935 11:132862609-132862631 CTGTGTCCTAGCTAGGATGCTGG - Intronic
1092490107 12:8937290-8937312 CATTGCCCGTGCCAAGATTCAGG + Exonic
1095094843 12:38141221-38141243 CAGGGTCCCTGACAGGATGGAGG - Intergenic
1096946196 12:55412123-55412145 CATTGCCCGTGCCAAGATTCAGG - Intergenic
1098199882 12:68043286-68043308 CAGTGGCAGTGCCTGGCTGCAGG + Intergenic
1100983402 12:100182146-100182168 CAGTTTCCAGGCCAGGGTGCAGG + Intergenic
1102046223 12:109832040-109832062 CAGTGGCTGTGCCAGGTTCCTGG + Intronic
1102897918 12:116613297-116613319 CAGGGTCAGTGCCAGGAGGTGGG + Intergenic
1103002204 12:117393739-117393761 CTCTGTACGTGCCAGGATTCTGG - Intronic
1103947611 12:124535269-124535291 CAGTGTCAGTGTCAGGAGGGTGG - Intronic
1104756964 12:131275417-131275439 CTGTGACCATGCCAGGGTGCAGG + Intergenic
1105357467 13:19672034-19672056 CTGTGTCTGTGCCAGTATGCCGG + Exonic
1105418159 13:20231312-20231334 CAGTGTCCCCGCCTGGTTGCAGG + Intronic
1105782264 13:23715559-23715581 CACTGCCCGAGCCAGGAGGCGGG + Intergenic
1108186143 13:47890353-47890375 CAGTGTGCATGACAGGAAGCTGG - Intergenic
1113709185 13:112452831-112452853 CAGAGTCCTTGCCCGGATGAGGG + Intergenic
1119483825 14:74975642-74975664 CAGTGTCTGTGCCAGAATCAAGG - Intergenic
1122738045 14:103855157-103855179 CACTGTGGGTGCCAGGTTGCAGG - Intergenic
1129394630 15:75237229-75237251 CAGTGTCCAGGACAGGATGGGGG + Intergenic
1129747264 15:78031918-78031940 CAGTTTCCAGGCCAGGCTGCAGG + Intronic
1130093228 15:80838283-80838305 CAGGGTCCCTGCCAGGAAGGAGG - Intronic
1131515790 15:93075721-93075743 CAGTGTCCCTGCCGGGAGACGGG + Intronic
1132373570 15:101313755-101313777 CACTGGCCGTGCCACGATGATGG + Intronic
1133222041 16:4322988-4323010 CAGTGTCGGGGCCAGGACTCAGG - Intronic
1133279253 16:4655817-4655839 CAGTTTCCTTGTCAGGAGGCAGG - Intronic
1134748534 16:16607021-16607043 CATTTTCGGTGCCAGGATGCTGG + Intergenic
1134996931 16:18746595-18746617 CATTTTCGGTGCCAGGATGCTGG - Intergenic
1136139488 16:28279535-28279557 CTGTGCCCGTGACAGAATGCGGG - Intergenic
1139927278 16:70496600-70496622 CAGTGTCCTTGACGGGGTGCTGG - Intronic
1141149346 16:81553260-81553282 CAGTGCCCAGGCCAGGACGCAGG - Intronic
1141251710 16:82364649-82364671 CAGTGTCCTGGACAGGATCCCGG - Intergenic
1141537211 16:84690386-84690408 CAGTGTTTGTGCTAGAATGCTGG + Intergenic
1142096416 16:88242348-88242370 CAGAGTCCGAGTCAGGGTGCCGG + Intergenic
1142143689 16:88483704-88483726 CAGGTGCCGTTCCAGGATGCAGG - Intronic
1142184927 16:88690311-88690333 CAGTGCCAGTGCCAGGTGGCTGG + Intergenic
1142309465 16:89303913-89303935 TAGAGGCTGTGCCAGGATGCGGG - Intronic
1142395159 16:89828069-89828091 CAGTGTCCCGGGCTGGATGCCGG + Intronic
1142741915 17:1936520-1936542 CAGTGTCCAGGCCAGGAGGGAGG + Exonic
1145018929 17:19415358-19415380 CTGTCTCCCTGCCAGAATGCTGG - Intronic
1145742333 17:27285762-27285784 CTGTGTCTGGGCCAGAATGCTGG - Intergenic
1145787164 17:27601634-27601656 CAGTCTCTGTGCCAAGAGGCTGG - Intronic
1145908248 17:28528061-28528083 CTGTCTCAGTGCCAGGCTGCAGG - Intronic
1147132391 17:38417192-38417214 CAGTCTCTGTGCCAGCCTGCAGG - Intergenic
1152956306 18:44960-44982 CAGAGGCCCTGCCTGGATGCTGG + Intergenic
1153457403 18:5295812-5295834 CTGTGCCTGTGCCAGGCTGCAGG - Exonic
1160300944 18:77677770-77677792 CAGTCTCCTGGCCAGGATGTTGG - Intergenic
1160340569 18:78085520-78085542 CAGTGTGAGTGCCGGGCTGCGGG - Intergenic
1160660473 19:295849-295871 CCATGGCCGTGCCAGGAAGCAGG - Intergenic
1161017753 19:1991639-1991661 CTGGGTCCTTTCCAGGATGCCGG + Intronic
1163626658 19:18394061-18394083 CAGAGTCCGTGCCAGGAGGTGGG - Intronic
1163700077 19:18782511-18782533 CAGTGTCCGCCCCAGGATTCTGG - Intergenic
1164830126 19:31313865-31313887 GAGTGTCGGTGCCAGGATGCAGG - Intronic
1165272457 19:34722763-34722785 CTGTCTACGTTCCAGGATGCTGG + Intergenic
1167015517 19:46838586-46838608 CAGGGTCCGGGCCAGCATCCTGG - Intronic
1202648501 1_KI270706v1_random:160975-160997 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
925261252 2:2530431-2530453 CTGTGTCTGTGCCAGGCTGGAGG - Intergenic
930271608 2:49263848-49263870 CAGTGTGCCTAGCAGGATGCTGG - Intergenic
930825512 2:55693293-55693315 CAGGGTCCGGGCCAGCATCCCGG + Intronic
931231548 2:60379378-60379400 CAGTGTCAGAGCCATGATTCAGG + Intergenic
931248628 2:60511183-60511205 CAGTGCCCCTGCCAGGAGGAGGG - Intronic
934886232 2:98027953-98027975 CACTGTCCTTGCCAGCCTGCTGG - Intergenic
937303298 2:120856429-120856451 CTGTGCCCGGGCCAGGAAGCAGG + Intronic
941099772 2:161282634-161282656 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
948189278 2:236045662-236045684 CTGAGTCCGTGCCAGGAGGCTGG + Intronic
948758289 2:240172254-240172276 AAGTGGCCAGGCCAGGATGCTGG - Intergenic
948894402 2:240921606-240921628 AAGTGTGGGTGCCAGGAGGCTGG + Intronic
1169313742 20:4570858-4570880 CAGTGGAAGTGGCAGGATGCTGG - Intergenic
1170941855 20:20854621-20854643 CAGGGTCATGGCCAGGATGCTGG - Intergenic
1173686284 20:44925554-44925576 CAGTGTGAGTGACAGGATGGGGG + Intronic
1175228188 20:57457337-57457359 AAGTGCTCGAGCCAGGATGCGGG + Intergenic
1175322553 20:58099655-58099677 CAGTGTGCGTCACTGGATGCAGG + Intergenic
1175653407 20:60748573-60748595 CAGTCACAGTGTCAGGATGCTGG + Intergenic
1175812229 20:61864543-61864565 CAGTGGCCGCTCCAGGATCCTGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176382822 21:6121527-6121549 CAGTGTCCGTGCCAGGATGCAGG - Exonic
1176603352 21:8811712-8811734 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
1179377503 21:40863981-40864003 CGGACTCCATGCCAGGATGCAGG + Intergenic
1179381239 21:40901213-40901235 CAATGTCCCTGAAAGGATGCAGG - Intergenic
1179740647 21:43416712-43416734 CAGTGTCCGTGCCAGGATGCAGG + Exonic
1180345637 22:11703269-11703291 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
1180352078 22:11814043-11814065 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1180386131 22:12178023-12178045 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
1180609041 22:17084205-17084227 CCGAGTCCGAGCCAGGAGGCTGG + Intergenic
1180837265 22:18936165-18936187 CAGCGGCCGTGCCAGGAGGTGGG - Exonic
1181001675 22:19990641-19990663 CACTGACCATGCCAGGCTGCTGG + Exonic
1181064700 22:20299860-20299882 CAGGGGCCGTGCCAGGACGTGGG + Intergenic
1182117062 22:27762673-27762695 CAGTTTCTGTGCGAGCATGCTGG - Intronic
1183080582 22:35453205-35453227 CAGTGTCTGTGCCTGGACCCAGG - Intergenic
1183653678 22:39173145-39173167 CAGTGTCACTGCCAGGAGTCGGG - Intergenic
1184058417 22:42067409-42067431 CAGAGGCCGGGCCAGCATGCTGG - Intronic
1203287358 22_KI270734v1_random:161464-161486 CAGCGGCCGTGCCAGGAGGTGGG - Intergenic
956146899 3:66199422-66199444 CAGTGTCAGGGCCAGGATAAGGG - Intronic
959599890 3:108169811-108169833 CAGTTTCAGCCCCAGGATGCAGG + Intronic
961166086 3:124764841-124764863 CAGTCTCCATTGCAGGATGCTGG + Intronic
961808616 3:129507527-129507549 CAGTGTCTGTGCCAGGGTGAGGG - Intronic
968070309 3:195780521-195780543 AAGTGTCCGTGACAGGAAGACGG + Exonic
968070345 3:195780713-195780735 AAGTGTCCGTGACAGGAAGACGG + Exonic
968070646 3:195782345-195782367 AAGTGTCGGTGACAGGAAGCGGG + Exonic
968070665 3:195782441-195782463 AAGTGTCGGTGACAGGAAGCGGG + Exonic
968070967 3:195784169-195784191 AAGTGTCGGTGCCAGGAAGAGGG + Exonic
968358028 3:198123281-198123303 CAGAGGCCCTGCCTGGATGCTGG - Intergenic
968680870 4:1918547-1918569 CAGTCTCCATGCCACGAAGCAGG + Exonic
968752646 4:2398216-2398238 CAGTGCCCGTGCCAGGGTGCAGG + Intronic
969488579 4:7485973-7485995 CAGTGAGGGTGCCAGGATGCAGG - Intronic
973374726 4:49278939-49278961 CAGTGTCAATGCCAGGAAGGAGG + Intergenic
973375630 4:49284961-49284983 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
973376527 4:49290980-49291002 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
973377447 4:49297132-49297154 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
973378367 4:49303268-49303290 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
973380695 4:49318235-49318257 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
973381781 4:49325280-49325302 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
973382685 4:49331302-49331324 CAGTGTCAATGCCAGGAAGGAGG - Intergenic
976085543 4:81403747-81403769 CAGTTTCCTTCCTAGGATGCTGG - Intergenic
983238558 4:165207102-165207124 CAGTGTCCCAGGCAGGAAGCAGG - Intronic
985682646 5:1264607-1264629 CAATGTCAGCCCCAGGATGCGGG + Intronic
986294329 5:6424457-6424479 TAGTGCCAGTGCCAGGATGGAGG - Intergenic
992133211 5:73716277-73716299 CAGTGTCCATGCCAGCATGAAGG + Intronic
992360040 5:76028133-76028155 CAGTTTCCAAGCCATGATGCGGG - Intergenic
1002041951 5:176521103-176521125 CAGTGCCCGTTCCAGCATGCAGG - Intergenic
1004567129 6:16808430-16808452 CAGTGTCCTTGCAGGGATGAGGG - Intergenic
1011955742 6:93023389-93023411 CATAGTCCGTGCTAGGATTCAGG + Intergenic
1013048456 6:106510416-106510438 CAGTGCCCGCGCCAGAAGGCGGG - Intergenic
1013400316 6:109788812-109788834 CAGTGTCCTTGCCAGAAGCCAGG + Intronic
1013727793 6:113121178-113121200 CCCTGTCTGTGGCAGGATGCTGG + Intergenic
1015941004 6:138451906-138451928 AAGTGACAGTGCCAGGATGCTGG - Intronic
1017039561 6:150296688-150296710 GAGTTTCCGCGCCAGGCTGCAGG - Intergenic
1018317583 6:162572074-162572096 AAGTCTAGGTGCCAGGATGCAGG - Intronic
1020022603 7:4878044-4878066 CAGCGTCCGGGACAGCATGCTGG + Exonic
1022580923 7:31553304-31553326 CAGTGTTCCTGGCATGATGCCGG + Intronic
1034349594 7:150407489-150407511 GAGTGTCCCTGCCAGGCTGGGGG + Intronic
1035394755 7:158527579-158527601 CAGTGTCCCTCCCAGGCCGCTGG + Intronic
1039968017 8:42297949-42297971 AAGAGTCCTGGCCAGGATGCAGG - Intronic
1040553011 8:48453285-48453307 CAGTTCCCGAGCCAGGCTGCTGG + Intergenic
1046713622 8:117542800-117542822 TAATGTCCTTACCAGGATGCTGG - Intergenic
1050101700 9:2126788-2126810 CAATCTCTGTGCCAGGAGGCTGG + Intronic
1056228340 9:84519009-84519031 AAGTGTCTGTACCAGGATGAGGG - Intergenic
1058528647 9:105885054-105885076 CAGGGTCCCTGGCAGGAAGCTGG - Intergenic
1060555926 9:124507170-124507192 CAGTGGCCGGCCCAGGCTGCAGG + Intronic
1061150663 9:128826329-128826351 CAGTGTCTGTGGCATGATCCAGG + Intronic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1062370436 9:136236041-136236063 CAGGGTCAGGGCCAGGATGGGGG + Intronic
1062741895 9:138179816-138179838 CAGAGGCCCTGCCTGGATGCTGG - Intergenic
1203698431 Un_GL000214v1:117044-117066 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203699348 Un_GL000214v1:123195-123217 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203700292 Un_GL000214v1:129478-129500 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203701214 Un_GL000214v1:135498-135520 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203480042 Un_GL000224v1:4081-4103 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203481975 Un_GL000224v1:16718-16740 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203416772 Un_KI270330v1:526-548 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
1203549877 Un_KI270743v1:157967-157989 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
1203550814 Un_KI270743v1:164132-164154 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
1203568002 Un_KI270744v1:108189-108211 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203569640 Un_KI270744v1:119432-119454 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1186042123 X:5492218-5492240 CAGTGTCCCTCCCAGGACACGGG - Intergenic
1187855984 X:23636693-23636715 CAGTGTGTGTGCCAGAGTGCTGG - Intergenic
1190829866 X:54050019-54050041 CAGTTCCTGTGCCAGTATGCAGG - Intergenic
1198864550 X:141107599-141107621 AAGTGTCAGAGCCAGGATTCAGG - Intergenic
1198898141 X:141479808-141479830 AAGTGTCAGAGCCAGGATTCAGG + Intergenic
1200690121 Y:6299157-6299179 AAGTGTCAGAGCCAGGATTCAGG - Intergenic
1201045152 Y:9875559-9875581 AAGTGTCAGAGCCAGGATTCAGG + Intergenic