ID: 1176383775

View in Genome Browser
Species Human (GRCh38)
Location 21:6127036-6127058
Sequence CAGGGTGCACAGTGGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176383762_1176383775 28 Left 1176383762 21:6126985-6127007 CCACGCGTGCTCCGGGTCAGCAG No data
Right 1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG No data
1176383769_1176383775 -2 Left 1176383769 21:6127015-6127037 CCGTGACAAGGGCGCGACATGCA No data
Right 1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG No data
1176383768_1176383775 -1 Left 1176383768 21:6127014-6127036 CCCGTGACAAGGGCGCGACATGC No data
Right 1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG No data
1176383764_1176383775 17 Left 1176383764 21:6126996-6127018 CCGGGTCAGCAGGCCGCTCCCGT No data
Right 1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG No data
1176383767_1176383775 4 Left 1176383767 21:6127009-6127031 CCGCTCCCGTGACAAGGGCGCGA No data
Right 1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176383775 Original CRISPR CAGGGTGCACAGTGGGCCCT GGG Intergenic
No off target data available for this crispr