ID: 1176384130

View in Genome Browser
Species Human (GRCh38)
Location 21:6128664-6128686
Sequence CCGTGCCCTTGCCGTGTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176384125_1176384130 -6 Left 1176384125 21:6128647-6128669 CCCCTGGGCTCTCCGCTCCGTGC No data
Right 1176384130 21:6128664-6128686 CCGTGCCCTTGCCGTGTTCCCGG No data
1176384124_1176384130 4 Left 1176384124 21:6128637-6128659 CCAGAAAGCTCCCCTGGGCTCTC No data
Right 1176384130 21:6128664-6128686 CCGTGCCCTTGCCGTGTTCCCGG No data
1176384127_1176384130 -8 Left 1176384127 21:6128649-6128671 CCTGGGCTCTCCGCTCCGTGCCC No data
Right 1176384130 21:6128664-6128686 CCGTGCCCTTGCCGTGTTCCCGG No data
1176384126_1176384130 -7 Left 1176384126 21:6128648-6128670 CCCTGGGCTCTCCGCTCCGTGCC No data
Right 1176384130 21:6128664-6128686 CCGTGCCCTTGCCGTGTTCCCGG No data
1176384123_1176384130 5 Left 1176384123 21:6128636-6128658 CCCAGAAAGCTCCCCTGGGCTCT No data
Right 1176384130 21:6128664-6128686 CCGTGCCCTTGCCGTGTTCCCGG No data
1176384120_1176384130 12 Left 1176384120 21:6128629-6128651 CCTGTCACCCAGAAAGCTCCCCT No data
Right 1176384130 21:6128664-6128686 CCGTGCCCTTGCCGTGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176384130 Original CRISPR CCGTGCCCTTGCCGTGTTCC CGG Intergenic
No off target data available for this crispr