ID: 1176384684

View in Genome Browser
Species Human (GRCh38)
Location 21:6133475-6133497
Sequence GGTGCAGGCTTGGGACTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176384684_1176384695 29 Left 1176384684 21:6133475-6133497 CCTACAAGTCCCAAGCCTGCACC No data
Right 1176384695 21:6133527-6133549 GCCTTGCCACGCGTGACGTCTGG No data
1176384684_1176384691 2 Left 1176384684 21:6133475-6133497 CCTACAAGTCCCAAGCCTGCACC No data
Right 1176384691 21:6133500-6133522 AGCCAGCCAGTTCCGGCTGTAGG No data
1176384684_1176384689 -5 Left 1176384684 21:6133475-6133497 CCTACAAGTCCCAAGCCTGCACC No data
Right 1176384689 21:6133493-6133515 GCACCGGAGCCAGCCAGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176384684 Original CRISPR GGTGCAGGCTTGGGACTTGT AGG (reversed) Intergenic