ID: 1176384686

View in Genome Browser
Species Human (GRCh38)
Location 21:6133484-6133506
Sequence GCTGGCTCCGGTGCAGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176384686_1176384695 20 Left 1176384686 21:6133484-6133506 CCCAAGCCTGCACCGGAGCCAGC No data
Right 1176384695 21:6133527-6133549 GCCTTGCCACGCGTGACGTCTGG No data
1176384686_1176384698 27 Left 1176384686 21:6133484-6133506 CCCAAGCCTGCACCGGAGCCAGC No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG 0: 2
1: 0
2: 0
3: 2
4: 58
1176384686_1176384691 -7 Left 1176384686 21:6133484-6133506 CCCAAGCCTGCACCGGAGCCAGC No data
Right 1176384691 21:6133500-6133522 AGCCAGCCAGTTCCGGCTGTAGG No data
1176384686_1176384699 30 Left 1176384686 21:6133484-6133506 CCCAAGCCTGCACCGGAGCCAGC No data
Right 1176384699 21:6133537-6133559 GCGTGACGTCTGGCACCTGGCGG 0: 2
1: 0
2: 0
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176384686 Original CRISPR GCTGGCTCCGGTGCAGGCTT GGG (reversed) Intergenic