ID: 1176384687

View in Genome Browser
Species Human (GRCh38)
Location 21:6133485-6133507
Sequence GGCTGGCTCCGGTGCAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176384687_1176384698 26 Left 1176384687 21:6133485-6133507 CCAAGCCTGCACCGGAGCCAGCC No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG No data
1176384687_1176384691 -8 Left 1176384687 21:6133485-6133507 CCAAGCCTGCACCGGAGCCAGCC No data
Right 1176384691 21:6133500-6133522 AGCCAGCCAGTTCCGGCTGTAGG No data
1176384687_1176384699 29 Left 1176384687 21:6133485-6133507 CCAAGCCTGCACCGGAGCCAGCC No data
Right 1176384699 21:6133537-6133559 GCGTGACGTCTGGCACCTGGCGG No data
1176384687_1176384695 19 Left 1176384687 21:6133485-6133507 CCAAGCCTGCACCGGAGCCAGCC No data
Right 1176384695 21:6133527-6133549 GCCTTGCCACGCGTGACGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176384687 Original CRISPR GGCTGGCTCCGGTGCAGGCT TGG (reversed) Intergenic